Prupe.2G246200_v2.0.a1

signal peptidase complex subunit

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
26311575 .. 26312294
720 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G246200.1

Sequence Viewer

Length: 183 bp
ATGTACACACTTGTGATAGCAAGTGCAGACCCCAAATCTATTTCCTCAAATCAACCAGTAAAGTTTACCAAGAGTGTTACTCAGTGGTTCACCAAGGATGGGATTTTGGTGGAGGGCCTCTTCTGGAAAGATGTTGAAGCTTTAATAAATGAATACCAGAAAGAACCAAAGAAGAGCAAGTGA

Protein Analysis

61

Amino Acids

6.86

Weight (kDa)

9.0

Isoelectric Point (pI)

21.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 99
AgsI TTSAA 1 cut(s) 137
AleI CACNNNNGTG 1 cut(s) 11
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
AoxI GGCC 1 cut(s) 115
AspS9I GGNCC 1 cut(s) 115
AsuHPI GGTGA 1 cut(s) 82
BccI CCATC 1 cut(s) 92
BmgT120I GGNCC 1 cut(s) 115
BplI GAGNNNNNCTC 2 cut(s) 64, 96
BsaJI CCNNGG 1 cut(s) 93
Bsc4I CCNNNNNNNGG 1 cut(s) 99
Bse1I ACTGG 1 cut(s) 56
BseDI CCNNGG 1 cut(s) 93
BseGI GGATG 1 cut(s) 103
BseLI CCNNNNNNNGG 1 cut(s) 99
BseMII CTCAG 1 cut(s) 95
BseNI ACTGG 1 cut(s) 56
BsgI GTGCAG 1 cut(s) 45
BshFI GGCC 1 cut(s) 117
BslI CCNNNNNNNGG 1 cut(s) 99
BsnI GGCC 1 cut(s) 117
Bsp1407I TGTACA 1 cut(s) 3
BspANI GGCC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 94
BspQI GCTCTTC 1 cut(s) 167
BsrGI TGTACA 1 cut(s) 3
BsrI ACTGG 1 cut(s) 56
BssECI CCNNGG 1 cut(s) 93
BssT1I CCWWGG 1 cut(s) 93
Bst6I CTCTTC 2 cut(s) 125, 167
BstAUI TGTACA 1 cut(s) 3
BstDEI CTNAG 1 cut(s) 81
BstF5I GGATG 1 cut(s) 103
BsuRI GGCC 1 cut(s) 117
BtsCI GGATG 1 cut(s) 103
BtsIMutI CAGTG 1 cut(s) 89
Cfr13I GGNCC 1 cut(s) 115
Csp6I GTAC 1 cut(s) 4
CviJI RGCY 2 cut(s) 117, 140
CviKI_1 RGCY 2 cut(s) 117, 140
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 81
Eam1104I CTCTTC 2 cut(s) 125, 167
EarI CTCTTC 2 cut(s) 125, 167
Eco130I CCWWGG 1 cut(s) 93
EcoO109I RGGNCCY 1 cut(s) 115
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FokI GGATG 1 cut(s) 110
HaeIII GGCC 1 cut(s) 117
HindIII AAGCTT 1 cut(s) 138
HphI GGTGA 1 cut(s) 82
Hpy166II GTNNAC 3 cut(s) 6, 66, 90
Hpy188III TCNNGA 1 cut(s) 124
Hpy8I GTNNAC 3 cut(s) 6, 66, 90
HpyCH4V TGCA 1 cut(s) 26
HpyF3I CTNAG 1 cut(s) 81
LguI GCTCTTC 1 cut(s) 167
LpnPI CCDG 3 cut(s) 69, 109, 170
MaeIII GTNAC 1 cut(s) 76
MboII GAAGA 1 cut(s) 112
MnlI CCTC 3 cut(s) 55, 106, 128
MseI TTAA 1 cut(s) 143
MslI CAYNNNNRTG 1 cut(s) 11
OliI CACNNNNGTG 1 cut(s) 11
PciSI GCTCTTC 1 cut(s) 167
PspPI GGNCC 1 cut(s) 115
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
RseI CAYNNNNRTG 1 cut(s) 11
SapI GCTCTTC 1 cut(s) 167
SaqAI TTAA 1 cut(s) 143
Sau96I GGNCC 1 cut(s) 115
SetI ASST 1 cut(s) 142
SgeI CNNG 7 cut(s) 23, 33, 68, 82, 106, 136, 169
SmiMI CAYNNNNRTG 1 cut(s) 11
StyI CCWWGG 1 cut(s) 93
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 1 cut(s) 143
Tru9I TTAA 1 cut(s) 143
TscAI CASTG 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 165
TspRI CASTG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.