Prupe.3G141600_v2.0.a1

Vacuolar protein sorting-associated protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Reverse (-)
15154386 .. 15156332
1947 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G141600.1

Sequence Viewer

Length: 144 bp
ATGTTATTAGAGAAGCCGGTTGATTTGTTTAAAGTACGTGGGAAGTTTGCCTTATCATATGTTTATGAAGATCGCTTTTTACTCTACAAAGGGAAAATTCTTCTAGTCACTCATCGAAGATTGATACTGTGGCAAGTAAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

48

Amino Acids

5.7

Weight (kDa)

9.99

Isoelectric Point (pI)

16.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 96
AfaI GTAC 1 cut(s) 36
ApoI RAATTY 1 cut(s) 96
BfaI CTAG 1 cut(s) 104
BsaAI YACGTR 1 cut(s) 38
Bse118I RCCGGY 1 cut(s) 16
BsiSI CCGG 1 cut(s) 17
Bsp143I GATC 1 cut(s) 70
BsrFI RCCGGY 1 cut(s) 16
BssAI RCCGGY 1 cut(s) 16
BssMI GATC 1 cut(s) 70
Bst4CI ACNGT 1 cut(s) 129
BstBAI YACGTR 1 cut(s) 38
BstKTI GATC 1 cut(s) 73
BstMBI GATC 1 cut(s) 70
Cfr10I RCCGGY 1 cut(s) 16
Csp6I GTAC 1 cut(s) 35
CviJI RGCY 1 cut(s) 16
CviKI_1 RGCY 1 cut(s) 16
CviQI GTAC 1 cut(s) 35
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
DraI TTTAAA 1 cut(s) 31
FaiI YATR 3 cut(s) 58, 60, 66
FalI AAGNNNNNCTT 2 cut(s) 35, 67
FauNDI CATATG 1 cut(s) 58
FspBI CTAG 1 cut(s) 104
FspEI CC 8 cut(s) 2, 24, 25, 30, 64, 75, 76, 115
HapII CCGG 1 cut(s) 17
HpaII CCGG 1 cut(s) 17
HpyCH4III ACNGT 1 cut(s) 129
HpyCH4IV ACGT 1 cut(s) 37
HpySE526I ACGT 1 cut(s) 37
Kzo9I GATC 1 cut(s) 70
LpnPI CCDG 1 cut(s) 30
MaeI CTAG 1 cut(s) 104
MaeII ACGT 1 cut(s) 37
MaeIII GTNAC 1 cut(s) 106
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MboII GAAGA 3 cut(s) 80, 92, 129
MluCI AATT 1 cut(s) 96
MseI TTAA 1 cut(s) 30
MspI CCGG 1 cut(s) 17
NdeI CATATG 1 cut(s) 58
NdeII GATC 1 cut(s) 70
NmuCI GTSAC 1 cut(s) 106
Ppu21I YACGTR 1 cut(s) 38
RsaI GTAC 1 cut(s) 36
RsaNI GTAC 1 cut(s) 35
SaqAI TTAA 1 cut(s) 30
Sau3AI GATC 1 cut(s) 70
SetI ASST 1 cut(s) 40
SgeI CNNG 3 cut(s) 29, 50, 116
Sse9I AATT 1 cut(s) 96
SspMI CTAG 1 cut(s) 104
TaaI ACNGT 1 cut(s) 129
TaiI ACGT 1 cut(s) 40
TaqI TCGA 1 cut(s) 115
TasI AATT 1 cut(s) 96
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TseFI GTSAC 1 cut(s) 106
Tsp45I GTSAC 1 cut(s) 106
TspDTI ATGAA 1 cut(s) 81
XapI RAATTY 1 cut(s) 96
XspI CTAG 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.