Rroxscaffold_5G00368530

Vacuolar protein sorting-associated protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
50267827 .. 50303481
35655 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00368530.1

Sequence Viewer

Length: 258 bp
ATGAGGGAGCAAGCTCGTGTAATAAAGTGCATCCATGACACCCCCCAGGCTTTTGAAGTGTACACCTCAATTGAACGAGCAATGAGCATTTATGGACCAAACAAAACAAAGGAAAGGCCAACAAAAAATGTGACAAAGCCATATTCACCGCTTGCTGATAGCACCAGTGCTGAAGTTAACCCAAAAGAAGGGCTTAGCTCCTTGTCACCCCGACCGATGGCACTTCCTCGTTCAATGTTTGGCAGGAGTGCCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

85

Amino Acids

9.47

Weight (kDa)

9.73

Isoelectric Point (pI)

50.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 149
AcuI CTGAAG 1 cut(s) 192
AfaI GTAC 1 cut(s) 62
AfiI CCNNNNNNNGG 2 cut(s) 188, 217
AgsI TTSAA 3 cut(s) 56, 74, 234
AjnI CCWGG 1 cut(s) 45
AluBI AGCT 2 cut(s) 14, 198
AluI AGCT 2 cut(s) 14, 198
AoxI GGCC 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 95
AsuHPI GGTGA 2 cut(s) 138, 198
AvaII GGWCC 1 cut(s) 95
BauI CACGAG 1 cut(s) 15
BccI CCATC 1 cut(s) 211
BciT130I CCWGG 1 cut(s) 47
BlpI GCTNAGC 1 cut(s) 194
Bme1390I CCNGG 1 cut(s) 47
Bme18I GGWCC 1 cut(s) 95
BmgT120I GGNCC 1 cut(s) 95
BmrFI CCNGG 1 cut(s) 47
BmsI GCATC 1 cut(s) 39
Bpu1102I GCTNAGC 1 cut(s) 194
BsaJI CCNNGG 1 cut(s) 45
Bsc4I CCNNNNNNNGG 2 cut(s) 188, 217
Bse1I ACTGG 1 cut(s) 165
Bse3DI GCAATG 1 cut(s) 87
BseBI CCWGG 1 cut(s) 47
BseDI CCNNGG 1 cut(s) 45
BseGI GGATG 1 cut(s) 30
BseLI CCNNNNNNNGG 2 cut(s) 188, 217
BseMI GCAATG 1 cut(s) 87
BseNI ACTGG 1 cut(s) 165
Bsh1285I CGRYCG 1 cut(s) 215
BshFI GGCC 1 cut(s) 118
BsiEI CGRYCG 1 cut(s) 215
BslI CCNNNNNNNGG 2 cut(s) 188, 217
BsnI GGCC 1 cut(s) 118
Bsp1407I TGTACA 1 cut(s) 60
Bsp1720I GCTNAGC 1 cut(s) 194
BspACI CCGC 1 cut(s) 149
BspANI GGCC 1 cut(s) 118
BsrDI GCAATG 1 cut(s) 87
BsrGI TGTACA 1 cut(s) 60
BsrI ACTGG 1 cut(s) 165
BssECI CCNNGG 1 cut(s) 45
BssSI CACGAG 1 cut(s) 15
Bst2BI CACGAG 1 cut(s) 15
Bst2UI CCWGG 1 cut(s) 47
BstAUI TGTACA 1 cut(s) 60
BstC8I GCNNGC 2 cut(s) 12, 153
BstDEI CTNAG 1 cut(s) 194
BstF5I GGATG 1 cut(s) 30
BstMCI CGRYCG 1 cut(s) 215
BstNI CCWGG 1 cut(s) 47
BstSCI CCNGG 1 cut(s) 45
BsuRI GGCC 1 cut(s) 118
BtsCI GGATG 1 cut(s) 30
BtsIMutI CAGTG 1 cut(s) 172
Cac8I GCNNGC 2 cut(s) 12, 153
Cfr13I GGNCC 1 cut(s) 95
Csp6I GTAC 1 cut(s) 61
CviAII CATG 1 cut(s) 35
CviJI RGCY 6 cut(s) 14, 50, 118, 139, 193, 198
CviKI_1 RGCY 6 cut(s) 14, 50, 118, 139, 193, 198
CviQI GTAC 1 cut(s) 61
DdeI CTNAG 1 cut(s) 194
Eco47I GGWCC 1 cut(s) 95
Eco57I CTGAAG 1 cut(s) 192
EcoRII CCWGG 1 cut(s) 45
FaeI CATG 1 cut(s) 38
FaiI YATR 3 cut(s) 36, 93, 142
FalI AAGNNNNNCTT 2 cut(s) 177, 209
FatI CATG 1 cut(s) 34
FokI GGATG 1 cut(s) 17
HaeIII GGCC 1 cut(s) 118
Hin1II CATG 1 cut(s) 38
HincII GTYRAC 1 cut(s) 178
HindII GTYRAC 1 cut(s) 178
HpaI GTTAAC 1 cut(s) 178
HphI GGTGA 2 cut(s) 138, 198
Hpy166II GTNNAC 3 cut(s) 61, 63, 178
Hpy8I GTNNAC 3 cut(s) 61, 63, 178
HpyAV CCTTC 1 cut(s) 182
HpyCH4V TGCA 1 cut(s) 30
HpyF3I CTNAG 1 cut(s) 194
Hsp92II CATG 1 cut(s) 38
KspAI GTTAAC 1 cut(s) 178
LmnI GCTCC 2 cut(s) 7, 203
LpnPI CCDG 4 cut(s) 32, 59, 178, 229
LweI GCATC 1 cut(s) 39
MaeIII GTNAC 2 cut(s) 130, 204
MfeI CAATTG 1 cut(s) 69
MluCI AATT 1 cut(s) 69
MnlI CCTC 2 cut(s) 76, 237
MseI TTAA 1 cut(s) 177
MspR9I CCNGG 1 cut(s) 47
MunI CAATTG 1 cut(s) 69
MvaI CCWGG 1 cut(s) 47
NlaIII CATG 1 cut(s) 38
NmuCI GTSAC 2 cut(s) 130, 204
Psp6I CCWGG 1 cut(s) 45
PspGI CCWGG 1 cut(s) 45
PspPI GGNCC 1 cut(s) 95
RsaI GTAC 1 cut(s) 62
RsaNI GTAC 1 cut(s) 61
SaqAI TTAA 1 cut(s) 177
Sau96I GGNCC 1 cut(s) 95
ScrFI CCNGG 1 cut(s) 47
SetI ASST 3 cut(s) 16, 68, 200
SfaNI GCATC 1 cut(s) 39
SinI GGWCC 1 cut(s) 95
Sse9I AATT 1 cut(s) 69
SsiI CCGC 1 cut(s) 149
StyD4I CCNGG 1 cut(s) 45
TaqII GACCGA 1 cut(s) 229
TasI AATT 1 cut(s) 69
TatI WGTACW 1 cut(s) 60
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TscAI CASTG 1 cut(s) 172
TseFI GTSAC 2 cut(s) 130, 204
Tsp45I GTSAC 2 cut(s) 130, 204
TspRI CASTG 1 cut(s) 172
VpaK11BI GGWCC 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.