Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp03

Orthogroup ID

OG0004850

Physical Location & Seq

Genomic Coordinates Forward (+)

19224514 .. 19225499

Gene Structure 986 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.3G175400.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 600 bp

ATGGGGAAGAAAGTAAGCCAAACATCACTGAAAATATCTAAGAAAGAGAAGAAAGAGTTTAACAGTTTGATAAGACTCTTGAGGCCTAAAGTCTACATCACTGACAGCTCAAGCTTCAAGAGGCTTGTGCAAGACCTCACTGGCAATGGAGCCTCAAATCCAAACACTTCTTCCTCCTCACTGCACCCTCAGAAAAAACACAACTTGGTTGATGAGGAGCAAATCCCAGTTGTACATATTGTTGATGATCAGGATCGGGAGGATCAAGGAGACACTGAAGGCAGTTTGGATGCGTCTACCGACACGTCCACGCTTGATGATTACTCCGAATTGTGCAACCAAGTGTTTATGAGTGATCAAGAATTCAACCAGTTATGTTATCAGATATATTCAGATGATACAACAACAACAACAAATTATGAAAGTTCAACAACAGACCAGTTATTGGTGGATGACATGTTACCTTTTCAAGATCTTGAGTCATGGCTTTTGGACACTGATCATCCTTATGATCCTTTTTTCAACAATGGTTTTGCTCAAATTGATCAGCAAGTCAGCATATACGACTACGAGCTATCGGGGCTACTATCATCGAATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

200

Amino Acids

22.59

Weight (kDa)

4.26

Isoelectric Point (pI)

31.78

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004850)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g30420 FvH4_6g38531 FvH4_6g38710
prunus_persica	Prupe.3G175400_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0151791
rosa_laevigata	RLG00000020582 RLG00000027644 RLG00000028957 RLG00000034011
rosa_multiflora	Rmu_sc0000021.1_g000006 Rmu_sc0002042.1_g000004 Rmu_sc0005294.1_g000028 Rmu_sc0007589.1_g000005 Rmu_sc0007589.1_g000007
rosa_roxburghii	Rroxscaffold_1G00039800 Rroxscaffold_2G00096150 Rroxscaffold_4G00294120
rosa_rugosa	Rorug01G0168000 Rorug01G0298300 Rorug02G0429100 Rorug02G0431600 Rorug05G0188400
rosa_samantha	Rh1BG151700 Rh1DG183600 Rh2AG489900 Rh2CG476200 Rh2DG513600 Rh5AG274000 Rh5BG279000 Rh5CG311100 Rh5DG287200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	445
AccI	GTMKAC	2 cut(s)	93, 296
AclWI	GGATC	3 cut(s)	261, 270, 506
AcsI	RAATTY	1 cut(s)	362
AcuI	CTGAAG	1 cut(s)	297
AfaI	GTAC	1 cut(s)	234
AfiI	CCNNNNNNNGG	1 cut(s)	445
AflIII	ACRYGT	2 cut(s)	303, 456
AgsI	TTSAA	5 cut(s)	118, 367, 429, 470, 523
AjiI	CACGTC	1 cut(s)	306
AjuI	GAANNNNNNNTTGG	2 cut(s)	154, 186
AluBI	AGCT	3 cut(s)	108, 114, 574
AluI	AGCT	3 cut(s)	108, 114, 574
Alw26I	GTCTC	1 cut(s)	264
AlwI	GGATC	3 cut(s)	261, 270, 506
AoxI	GGCC	1 cut(s)	83
ApoI	RAATTY	1 cut(s)	362
BclI	TGATCA	4 cut(s)	247, 355, 499, 544
BcoDI	GTCTC	1 cut(s)	264
BglII	AGATCT	1 cut(s)	472
BmgBI	CACGTC	1 cut(s)	306
BmiI	GGNNCC	1 cut(s)	151
BmrI	ACTGGG	1 cut(s)	221
BmsI	GCATC	1 cut(s)	280
BmuI	ACTGGG	1 cut(s)	221
BpuEI	CTTGAG	3 cut(s)	94, 100, 497
BsaBI	GATNNNNATC	1 cut(s)	252
Bsc4I	CCNNNNNNNGG	1 cut(s)	445
Bse1I	ACTGG	4 cut(s)	145, 227, 370, 439
Bse3DI	GCAATG	1 cut(s)	151
Bse8I	GATNNNNATC	1 cut(s)	252
BseGI	GGATG	3 cut(s)	295, 457, 502
BseJI	GATNNNNATC	1 cut(s)	252
BseLI	CCNNNNNNNGG	1 cut(s)	445
BseMI	GCAATG	1 cut(s)	151
BseMII	CTCAG	1 cut(s)	203
BseNI	ACTGG	4 cut(s)	145, 227, 370, 439
BseRI	GAGGAG	2 cut(s)	166, 230
BsgI	GTGCAG	1 cut(s)	167
BshFI	GGCC	1 cut(s)	85
BslI	CCNNNNNNNGG	1 cut(s)	445
BsmAI	GTCTC	1 cut(s)	264
BsnI	GGCC	1 cut(s)	85
Bsp1407I	TGTACA	1 cut(s)	232
Bsp143I	GATC	8 cut(s)	247, 253, 262, 355, 472, 499, 511, 544
BspANI	GGCC	1 cut(s)	85
BspCNI	CTCAG	1 cut(s)	202
BspLI	GGNNCC	1 cut(s)	151
BspPI	GGATC	3 cut(s)	261, 270, 506
BsrDI	GCAATG	1 cut(s)	151
BsrGI	TGTACA	1 cut(s)	232
BsrI	ACTGG	4 cut(s)	145, 227, 370, 439
BssMI	GATC	8 cut(s)	247, 253, 262, 355, 472, 499, 511, 544
Bst4CI	ACNGT	1 cut(s)	65
BstAUI	TGTACA	1 cut(s)	232
BstDEI	CTNAG	2 cut(s)	39, 189
BstF5I	GGATG	3 cut(s)	295, 457, 502
BstKTI	GATC	8 cut(s)	250, 256, 265, 358, 475, 502, 514, 547
BstMAI	GTCTC	1 cut(s)	264
BstMBI	GATC	8 cut(s)	247, 253, 262, 355, 472, 499, 511, 544
BstMWI	GCNNNNNNNGC	1 cut(s)	580
BstNSI	RCATGY	1 cut(s)	460
BstX2I	RGATCY	1 cut(s)	472
BstYI	RGATCY	1 cut(s)	472
BsuRI	GGCC	1 cut(s)	85
BtrI	CACGTC	1 cut(s)	306
BtsCI	GGATG	3 cut(s)	295, 457, 502
BtsI	GCAGTG	1 cut(s)	179
BtsIMutI	CAGTG	6 cut(s)	26, 99, 138, 179, 273, 495
CseI	GACGC	1 cut(s)	282
Csp6I	GTAC	1 cut(s)	233
CviAII	CATG	2 cut(s)	457, 483
CviJI	RGCY	9 cut(s)	18, 85, 108, 114, 124, 152, 487, 574, 583
CviKI_1	RGCY	9 cut(s)	18, 85, 108, 114, 124, 152, 487, 574, 583
CviQI	GTAC	1 cut(s)	233
DdeI	CTNAG	2 cut(s)	39, 189
DpnI	GATC	8 cut(s)	249, 255, 264, 357, 474, 501, 513, 546
DpnII	GATC	8 cut(s)	247, 253, 262, 355, 472, 499, 511, 544
Eco147I	AGGCCT	1 cut(s)	85
Eco57I	CTGAAG	1 cut(s)	297
EcoRI	GAATTC	1 cut(s)	362
FaeI	CATG	2 cut(s)	460, 486
FatI	CATG	2 cut(s)	456, 482
FbaI	TGATCA	4 cut(s)	247, 355, 499, 544
FblI	GTMKAC	2 cut(s)	93, 296
FokI	GGATG	3 cut(s)	302, 464, 489
HaeIII	GGCC	1 cut(s)	85
HgaI	GACGC	1 cut(s)	282
Hin1II	CATG	2 cut(s)	460, 486
HindIII	AAGCTT	1 cut(s)	112
HinfI	GANTC	2 cut(s)	75, 479
Hpy166II	GTNNAC	3 cut(s)	94, 297, 309
Hpy188I	TCNGA	4 cut(s)	192, 328, 384, 394
Hpy188III	TCNNGA	7 cut(s)	79, 118, 251, 257, 359, 470, 476
Hpy8I	GTNNAC	3 cut(s)	94, 297, 309
HpyAV	CCTTC	1 cut(s)	272
HpyCH4III	ACNGT	1 cut(s)	65
HpyCH4IV	ACGT	1 cut(s)	305
HpyCH4V	TGCA	3 cut(s)	130, 184, 336
HpyF10VI	GCNNNNNNNGC	1 cut(s)	580
HpyF3I	CTNAG	2 cut(s)	39, 189
HpySE526I	ACGT	1 cut(s)	305
Hsp92II	CATG	2 cut(s)	460, 486
Ksp22I	TGATCA	4 cut(s)	247, 355, 499, 544
Kzo9I	GATC	8 cut(s)	247, 253, 262, 355, 472, 499, 511, 544
LmnI	GCTCC	2 cut(s)	149, 217
LpnPI	CCDG	5 cut(s)	126, 236, 240, 383, 452
LweI	GCATC	1 cut(s)	280
MaeII	ACGT	1 cut(s)	305
MaeIII	GTNAC	1 cut(s)	459
MalI	GATC	8 cut(s)	249, 255, 264, 357, 474, 501, 513, 546
MboI	GATC	8 cut(s)	247, 253, 262, 355, 472, 499, 511, 544
MboII	GAAGA	3 cut(s)	19, 61, 162
MflI	RGATCY	1 cut(s)	472
MluCI	AATT	5 cut(s)	329, 362, 415, 540, 595
MlyI	GAGTC	2 cut(s)	69, 488
MnlI	CCTC	9 cut(s)	75, 114, 146, 163, 184, 187, 198, 208, 253
MseI	TTAA	2 cut(s)	60, 598
MslI	CAYNNNNRTG	1 cut(s)	507
MwoI	GCNNNNNNNGC	1 cut(s)	580
NdeII	GATC	8 cut(s)	247, 253, 262, 355, 472, 499, 511, 544
NlaIII	CATG	2 cut(s)	460, 486
NlaIV	GGNNCC	1 cut(s)	151
NspI	RCATGY	1 cut(s)	460
PceI	AGGCCT	1 cut(s)	85
PciI	ACATGT	1 cut(s)	456
PflMI	CCANNNNNTGG	1 cut(s)	445
PleI	GAGTC	2 cut(s)	69, 487
PpsI	GAGTC	2 cut(s)	69, 487
PscI	ACATGT	1 cut(s)	456
PspN4I	GGNNCC	1 cut(s)	151
PsuI	RGATCY	1 cut(s)	472
RsaI	GTAC	1 cut(s)	234
RsaNI	GTAC	1 cut(s)	233
RseI	CAYNNNNRTG	1 cut(s)	507
SaqAI	TTAA	2 cut(s)	60, 598
Sau3AI	GATC	8 cut(s)	247, 253, 262, 355, 472, 499, 511, 544
SchI	GAGTC	2 cut(s)	69, 488
SetI	ASST	6 cut(s)	110, 116, 138, 308, 466, 576
SfaNI	GCATC	1 cut(s)	280
SmiMI	CAYNNNNRTG	1 cut(s)	507
SmlI	CTYRAG	3 cut(s)	79, 109, 476
SmoI	CTYRAG	3 cut(s)	79, 109, 476
Sse9I	AATT	5 cut(s)	329, 362, 415, 540, 595
SseBI	AGGCCT	1 cut(s)	85
StuI	AGGCCT	1 cut(s)	85
TaaI	ACNGT	1 cut(s)	65
TaiI	ACGT	1 cut(s)	308
TaqI	TCGA	1 cut(s)	593
TasI	AATT	5 cut(s)	329, 362, 415, 540, 595
TatI	WGTACW	1 cut(s)	232
Tru1I	TTAA	2 cut(s)	60, 598
Tru9I	TTAA	2 cut(s)	60, 598
TscAI	CASTG	6 cut(s)	33, 106, 145, 186, 280, 502
TspDTI	ATGAA	1 cut(s)	435
TspRI	CASTG	6 cut(s)	33, 106, 145, 186, 280, 502
Van91I	CCANNNNNTGG	1 cut(s)	445
XapI	RAATTY	1 cut(s)	362
XceI	RCATGY	1 cut(s)	460
XmiI	GTMKAC	2 cut(s)	93, 296

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.