Rh1DG183600

VQ motif

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
37124757 .. 37125377
621 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG183600.1

Sequence Viewer

Length: 579 bp
ATGGGGATGAAAGTAAGCCAAACATCAGAGAAAATATCTAAGAAAGAAAAGAAGGAACTTAGCAGTTTGATAAGACTCTTGAAGCCAAAAGTCTACATCACTGACAGCTCAAGCTTCAAGATGCTTGTACAAGACCTCACAGGAAAGGGAAGCTCAAACATTTCAATCACTACTTCCTCATCACACCCCAAGATACAACAACACAAAGTACTTGTTGAGGAAGAGGAAGTACCAGTTGTAAATATTGAGGAGGATCAAGGAGAGCCTCAAGGGAGTACTAGTGTGGATGTGTCAACTGATGCATCATTAGATTCTTCCGAGCTATTCAACCAAGATGTTTTGCTGAATGACCAAGAATTGAATCAAATATGTTATCAGACGTATTCAGATGATACAACAACTACTACTACTTTAGAAGGTTCTAATTCGACAGTGGACCAATTGGTGGATATGTTACCTTTTCAAGATCTTGAGTCATGGCTTTTAGGTACTGAGCCTTTTGATTCTTTCAACAATAGTTATGCTCAGATTTTTCAAGAGTTCAGTGGAAACGACTATGACCTGTCGGGGATACTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

192

Amino Acids

21.35

Weight (kDa)

4.2

Isoelectric Point (pI)

50.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 445
AccI GTMKAC 1 cut(s) 93
AclWI GGATC 1 cut(s) 261
AfaI GTAC 5 cut(s) 129, 210, 231, 277, 490
AfiI CCNNNNNNNGG 1 cut(s) 445
AgsI TTSAA 8 cut(s) 82, 118, 165, 328, 361, 464, 511, 536
AhlI ACTAGT 1 cut(s) 278
AluBI AGCT 4 cut(s) 108, 114, 153, 322
AluI AGCT 4 cut(s) 108, 114, 153, 322
AlwI GGATC 1 cut(s) 261
AspS9I GGNCC 1 cut(s) 436
AvaII GGWCC 1 cut(s) 436
BarI GAAGNNNNNNTAC 2 cut(s) 213, 245
BciVI GTATCC 1 cut(s) 564
BcuI ACTAGT 1 cut(s) 278
BfaI CTAG 1 cut(s) 279
BfuI GTATCC 1 cut(s) 564
BglII AGATCT 1 cut(s) 466
BmcAI AGTACT 2 cut(s) 210, 277
Bme18I GGWCC 1 cut(s) 436
BmgT120I GGNCC 1 cut(s) 436
BmsI GCATC 3 cut(s) 111, 289, 311
BpuEI CTTGAG 3 cut(s) 94, 252, 491
BsaXI ACNNNNNCTCC 2 cut(s) 265, 295
Bsc4I CCNNNNNNNGG 1 cut(s) 445
Bse1I ACTGG 1 cut(s) 233
BseGI GGATG 2 cut(s) 12, 292
BseLI CCNNNNNNNGG 1 cut(s) 445
BseMII CTCAG 2 cut(s) 483, 539
BseNI ACTGG 1 cut(s) 233
BseRI GAGGAG 1 cut(s) 263
BslI CCNNNNNNNGG 1 cut(s) 445
Bsp1407I TGTACA 1 cut(s) 127
Bsp143I GATC 2 cut(s) 253, 466
BspCNI CTCAG 2 cut(s) 484, 538
BspPI GGATC 1 cut(s) 261
BsrGI TGTACA 1 cut(s) 127
BsrI ACTGG 1 cut(s) 233
BssMI GATC 2 cut(s) 253, 466
Bst4CI ACNGT 1 cut(s) 433
Bst6I CTCTTC 1 cut(s) 216
BstAUI TGTACA 1 cut(s) 127
BstDEI CTNAG 4 cut(s) 39, 59, 492, 525
BstF5I GGATG 2 cut(s) 12, 292
BstKTI GATC 2 cut(s) 256, 469
BstMBI GATC 2 cut(s) 253, 466
BstX2I RGATCY 1 cut(s) 466
BstYI RGATCY 1 cut(s) 466
BsuI GTATCC 1 cut(s) 564
BtsCI GGATG 2 cut(s) 12, 292
BtsIMutI CAGTG 3 cut(s) 99, 438, 550
Cfr13I GGNCC 1 cut(s) 436
Csp6I GTAC 5 cut(s) 128, 209, 230, 276, 489
CviAII CATG 1 cut(s) 477
CviJI RGCY 9 cut(s) 18, 85, 108, 114, 153, 265, 322, 481, 496
CviKI_1 RGCY 9 cut(s) 18, 85, 108, 114, 153, 265, 322, 481, 496
CviQI GTAC 5 cut(s) 128, 209, 230, 276, 489
DdeI CTNAG 4 cut(s) 39, 59, 492, 525
DpnI GATC 2 cut(s) 255, 468
DpnII GATC 2 cut(s) 253, 466
Eam1104I CTCTTC 1 cut(s) 216
EarI CTCTTC 1 cut(s) 216
Eco47I GGWCC 1 cut(s) 436
EcoT22I ATGCAT 1 cut(s) 304
FaeI CATG 1 cut(s) 480
FaiI YATR 6 cut(s) 370, 452, 478, 522, 558, 577
FatI CATG 1 cut(s) 476
FblI GTMKAC 1 cut(s) 93
FokI GGATG 2 cut(s) 19, 299
FspBI CTAG 1 cut(s) 279
Hin1II CATG 1 cut(s) 480
HincII GTYRAC 1 cut(s) 294
HindII GTYRAC 1 cut(s) 294
HindIII AAGCTT 1 cut(s) 112
HinfI GANTC 5 cut(s) 75, 311, 361, 473, 503
Hpy166II GTNNAC 3 cut(s) 94, 294, 436
Hpy188I TCNGA 5 cut(s) 28, 319, 378, 388, 528
Hpy188III TCNNGA 5 cut(s) 79, 118, 464, 470, 536
Hpy8I GTNNAC 3 cut(s) 94, 294, 436
HpyAV CCTTC 2 cut(s) 46, 410
HpyCH4III ACNGT 1 cut(s) 433
HpyCH4IV ACGT 1 cut(s) 380
HpyCH4V TGCA 1 cut(s) 302
HpyF3I CTNAG 4 cut(s) 39, 59, 492, 525
HpySE526I ACGT 1 cut(s) 380
Hsp92II CATG 1 cut(s) 480
Kzo9I GATC 2 cut(s) 253, 466
LpnPI CCDG 3 cut(s) 126, 246, 575
LweI GCATC 3 cut(s) 111, 289, 311
MaeI CTAG 1 cut(s) 279
MaeII ACGT 1 cut(s) 380
MaeIII GTNAC 1 cut(s) 453
MalI GATC 2 cut(s) 255, 468
MboI GATC 2 cut(s) 253, 466
MboII GAAGA 2 cut(s) 233, 306
MfeI CAATTG 1 cut(s) 440
MflI RGATCY 1 cut(s) 466
MluCI AATT 3 cut(s) 356, 424, 440
MlyI GAGTC 2 cut(s) 69, 482
MnlI CCTC 7 cut(s) 146, 187, 211, 217, 241, 244, 276
Mph1103I ATGCAT 1 cut(s) 304
MunI CAATTG 1 cut(s) 440
NdeII GATC 2 cut(s) 253, 466
NlaIII CATG 1 cut(s) 480
NsiI ATGCAT 1 cut(s) 304
PfeI GAWTC 3 cut(s) 311, 361, 503
PflMI CCANNNNNTGG 1 cut(s) 445
PleI GAGTC 2 cut(s) 69, 481
PpsI GAGTC 2 cut(s) 69, 481
PspPI GGNCC 1 cut(s) 436
PsuI RGATCY 1 cut(s) 466
RsaI GTAC 5 cut(s) 129, 210, 231, 277, 490
RsaNI GTAC 5 cut(s) 128, 209, 230, 276, 489
Sau3AI GATC 2 cut(s) 253, 466
Sau96I GGNCC 1 cut(s) 436
ScaI AGTACT 2 cut(s) 210, 277
SchI GAGTC 2 cut(s) 69, 482
SfaNI GCATC 3 cut(s) 111, 289, 311
SinI GGWCC 1 cut(s) 436
SmlI CTYRAG 3 cut(s) 109, 267, 470
SmoI CTYRAG 3 cut(s) 109, 267, 470
SpeI ACTAGT 1 cut(s) 278
Sse9I AATT 3 cut(s) 356, 424, 440
SspI AATATT 1 cut(s) 244
SspMI CTAG 1 cut(s) 279
TaaI ACNGT 1 cut(s) 433
TaiI ACGT 1 cut(s) 383
TaqI TCGA 1 cut(s) 428
TasI AATT 3 cut(s) 356, 424, 440
TatI WGTACW 3 cut(s) 127, 208, 275
TfiI GAWTC 3 cut(s) 311, 361, 503
TscAI CASTG 3 cut(s) 106, 438, 550
TspDTI ATGAA 1 cut(s) 23
TspRI CASTG 3 cut(s) 106, 438, 550
Van91I CCANNNNNTGG 1 cut(s) 445
VpaK11BI GGWCC 1 cut(s) 436
XmiI GTMKAC 1 cut(s) 93
XspI CTAG 1 cut(s) 279
ZrmI AGTACT 2 cut(s) 210, 277
Zsp2I ATGCAT 1 cut(s) 304
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.