Rmu_sc0007589.1_g000005

VQ motif

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007589.1
Physical Location & Seq
Reverse (-)
25419 .. 25925
507 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007589.1_g000005.1.cds

Sequence Viewer

Length: 507 bp
atggggaagaaagtaagccaaacatcagtgaaaatatataagaaagagaagaaggagtttaacagtttgattagaatcttgaggcctaaagtctacatcactgattgcttaagcttcaagacccttgtgcaagacctcaccggcaatggaagctctaatatctcaatcactacttcctcatcacaccctcagcaaccgcacagagtaccagttgtagatgttgaggagtatcaagtagagcctgaaaggagtactagtttcagtagtgtggatatctcaactgatgcatcatttgattcttccgagctctggaaccaagaaatgtttatgaatgaccaagaaataaaccaactgtgttaccagatgtattcagatgagttgccatttcaagatcttgagtcatggcttttgaggaccgagccttttgatccttccaatattaatggttatggtccgattgatcaagaggtcagcatatttgactatgagctgtcagggctactatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

168

Amino Acids

19.28

Weight (kDa)

4.48

Isoelectric Point (pI)

52.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 93
AciI CCGC 1 cut(s) 197
AclWI GGATC 1 cut(s) 422
AfaI GTAC 2 cut(s) 207, 253
AfiI CCNNNNNNNGG 1 cut(s) 309
AflII CTTAAG 1 cut(s) 109
AgsI TTSAA 2 cut(s) 118, 389
AhlI ACTAGT 1 cut(s) 254
AluBI AGCT 4 cut(s) 114, 153, 307, 490
AluI AGCT 4 cut(s) 114, 153, 307, 490
Alw21I GWGCWC 1 cut(s) 309
AlwI GGATC 1 cut(s) 422
AoxI GGCC 1 cut(s) 83
AseI ATTAAT 1 cut(s) 441
AspS9I GGNCC 2 cut(s) 414, 452
AsuHPI GGTGA 1 cut(s) 130
AvaII GGWCC 2 cut(s) 414, 452
BanII GRGCYC 1 cut(s) 309
Bbv12I GWGCWC 1 cut(s) 309
BbvCI CCTCAGC 1 cut(s) 189
BclI TGATCA 1 cut(s) 460
BcuI ACTAGT 1 cut(s) 254
BfaI CTAG 1 cut(s) 255
BfrI CTTAAG 1 cut(s) 109
BglII AGATCT 1 cut(s) 391
BmcAI AGTACT 1 cut(s) 253
Bme18I GGWCC 2 cut(s) 414, 452
BmgT120I GGNCC 2 cut(s) 414, 452
BmiI GGNNCC 1 cut(s) 314
BmsI GCATC 2 cut(s) 274, 296
Bpu10I CCTNAGC 1 cut(s) 189
BpuEI CTTGAG 2 cut(s) 100, 416
BsaBI GATNNNNATC 1 cut(s) 74
BsaXI ACNNNNNCTCC 2 cut(s) 241, 271
Bsc4I CCNNNNNNNGG 1 cut(s) 309
Bse118I RCCGGY 1 cut(s) 140
Bse1I ACTGG 1 cut(s) 209
Bse3DI GCAATG 1 cut(s) 151
Bse8I GATNNNNATC 1 cut(s) 74
BseJI GATNNNNATC 1 cut(s) 74
BseLI CCNNNNNNNGG 1 cut(s) 309
BseMI GCAATG 1 cut(s) 151
BseMII CTCAG 1 cut(s) 203
BseNI ACTGG 1 cut(s) 209
BseRI GAGGAG 1 cut(s) 239
BshFI GGCC 1 cut(s) 85
BsiHKAI GWGCWC 1 cut(s) 309
BsiSI CCGG 1 cut(s) 141
BslI CCNNNNNNNGG 1 cut(s) 309
BsnI GGCC 1 cut(s) 85
Bsp1286I GDGCHC 1 cut(s) 309
Bsp143I GATC 3 cut(s) 391, 427, 460
BspACI CCGC 1 cut(s) 197
BspANI GGCC 1 cut(s) 85
BspCNI CTCAG 1 cut(s) 202
BspLI GGNNCC 1 cut(s) 314
BspPI GGATC 1 cut(s) 422
BspTI CTTAAG 1 cut(s) 109
BsrDI GCAATG 1 cut(s) 151
BsrFI RCCGGY 1 cut(s) 140
BsrI ACTGG 1 cut(s) 209
BssAI RCCGGY 1 cut(s) 140
BssMI GATC 3 cut(s) 391, 427, 460
Bst4CI ACNGT 2 cut(s) 65, 354
BstAFI CTTAAG 1 cut(s) 109
BstDEI CTNAG 1 cut(s) 189
BstKTI GATC 3 cut(s) 394, 430, 463
BstMBI GATC 3 cut(s) 391, 427, 460
BstMWI GCNNNNNNNGC 2 cut(s) 150, 496
BstX2I RGATCY 1 cut(s) 391
BstYI RGATCY 1 cut(s) 391
BsuRI GGCC 1 cut(s) 85
BtsIMutI CAGTG 2 cut(s) 33, 99
Cfr10I RCCGGY 1 cut(s) 140
Cfr13I GGNCC 2 cut(s) 414, 452
Csp6I GTAC 2 cut(s) 206, 252
CviAII CATG 1 cut(s) 402
CviQI GTAC 2 cut(s) 206, 252
DdeI CTNAG 1 cut(s) 189
DpnI GATC 3 cut(s) 393, 429, 462
DpnII GATC 3 cut(s) 391, 427, 460
Ecl136II GAGCTC 1 cut(s) 307
Eco147I AGGCCT 1 cut(s) 85
Eco24I GRGCYC 1 cut(s) 309
Eco32I GATATC 1 cut(s) 274
Eco47I GGWCC 2 cut(s) 414, 452
Eco53kI GAGCTC 1 cut(s) 307
EcoICRI GAGCTC 1 cut(s) 307
EcoRV GATATC 1 cut(s) 274
EcoT22I ATGCAT 1 cut(s) 289
EcoT38I GRGCYC 1 cut(s) 309
FaeI CATG 1 cut(s) 405
FaiI YATR 8 cut(s) 37, 39, 329, 403, 450, 476, 486, 505
FatI CATG 1 cut(s) 401
FbaI TGATCA 1 cut(s) 460
FblI GTMKAC 1 cut(s) 93
FriOI GRGCYC 1 cut(s) 309
FspBI CTAG 1 cut(s) 255
HaeIII GGCC 1 cut(s) 85
HapII CCGG 1 cut(s) 141
Hin1II CATG 1 cut(s) 405
HindIII AAGCTT 1 cut(s) 112
HinfI GANTC 3 cut(s) 75, 296, 398
HpaII CCGG 1 cut(s) 141
HphI GGTGA 1 cut(s) 130
Hpy166II GTNNAC 1 cut(s) 94
Hpy188I TCNGA 3 cut(s) 304, 373, 456
Hpy188III TCNNGA 6 cut(s) 79, 118, 310, 389, 395, 464
Hpy8I GTNNAC 1 cut(s) 94
HpyAV CCTTC 2 cut(s) 46, 441
HpyCH4III ACNGT 2 cut(s) 65, 354
HpyCH4V TGCA 2 cut(s) 130, 287
HpyF10VI GCNNNNNNNGC 2 cut(s) 150, 496
HpyF3I CTNAG 1 cut(s) 189
Hsp92II CATG 1 cut(s) 405
Ksp22I TGATCA 1 cut(s) 460
Kzo9I GATC 3 cut(s) 391, 427, 460
LpnPI CCDG 6 cut(s) 154, 222, 255, 295, 374, 480
LweI GCATC 2 cut(s) 274, 296
MaeI CTAG 1 cut(s) 255
MaeIII GTNAC 1 cut(s) 356
MalI GATC 3 cut(s) 393, 429, 462
MboI GATC 3 cut(s) 391, 427, 460
MboII GAAGA 3 cut(s) 19, 61, 291
MflI RGATCY 1 cut(s) 391
MhlI GDGCHC 1 cut(s) 309
MlyI GAGTC 1 cut(s) 407
MnlI CCTC 7 cut(s) 75, 146, 187, 198, 217, 405, 460
Mph1103I ATGCAT 1 cut(s) 289
MseI TTAA 3 cut(s) 60, 110, 441
MspCI CTTAAG 1 cut(s) 109
MspI CCGG 1 cut(s) 141
MwoI GCNNNNNNNGC 2 cut(s) 150, 496
NdeII GATC 3 cut(s) 391, 427, 460
NlaIII CATG 1 cut(s) 405
NlaIV GGNNCC 1 cut(s) 314
NsiI ATGCAT 1 cut(s) 289
PceI AGGCCT 1 cut(s) 85
PfeI GAWTC 2 cut(s) 75, 296
PleI GAGTC 1 cut(s) 406
PpsI GAGTC 1 cut(s) 406
PshBI ATTAAT 1 cut(s) 441
Psp124BI GAGCTC 1 cut(s) 309
PspN4I GGNNCC 1 cut(s) 314
PspPI GGNCC 2 cut(s) 414, 452
PsuI RGATCY 1 cut(s) 391
RsaI GTAC 2 cut(s) 207, 253
RsaNI GTAC 2 cut(s) 206, 252
SacI GAGCTC 1 cut(s) 309
SaqAI TTAA 3 cut(s) 60, 110, 441
Sau3AI GATC 3 cut(s) 391, 427, 460
Sau96I GGNCC 2 cut(s) 414, 452
ScaI AGTACT 1 cut(s) 253
SchI GAGTC 1 cut(s) 407
SduI GDGCHC 1 cut(s) 309
SetI ASST 6 cut(s) 116, 138, 155, 309, 471, 492
SfaNI GCATC 2 cut(s) 274, 296
SinI GGWCC 2 cut(s) 414, 452
SmlI CTYRAG 3 cut(s) 79, 109, 395
SmoI CTYRAG 3 cut(s) 79, 109, 395
SpeI ACTAGT 1 cut(s) 254
SseBI AGGCCT 1 cut(s) 85
SsiI CCGC 1 cut(s) 197
SspI AATATT 1 cut(s) 439
SspMI CTAG 1 cut(s) 255
SstI GAGCTC 1 cut(s) 309
StuI AGGCCT 1 cut(s) 85
TaaI ACNGT 2 cut(s) 65, 354
TaqII GACCGA 1 cut(s) 431
TatI WGTACW 1 cut(s) 251
TfiI GAWTC 2 cut(s) 75, 296
Tru1I TTAA 3 cut(s) 60, 110, 441
Tru9I TTAA 3 cut(s) 60, 110, 441
TscAI CASTG 2 cut(s) 33, 106
TspDTI ATGAA 1 cut(s) 344
TspRI CASTG 2 cut(s) 33, 106
Vha464I CTTAAG 1 cut(s) 109
VpaK11BI GGWCC 2 cut(s) 414, 452
VspI ATTAAT 1 cut(s) 441
XmiI GTMKAC 1 cut(s) 93
XspI CTAG 1 cut(s) 255
ZrmI AGTACT 1 cut(s) 253
Zsp2I ATGCAT 1 cut(s) 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.