Rh2DG513600

VQ motif

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0004850
Physical Location & Seq
Forward (+)
73793801 .. 73806388
12588 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG513600.1

Sequence Viewer

Length: 699 bp
ATGGGGAAGAAAGTGAGCCAGACATCAGTGAAAATATCTAAGAAGGAGAAGAAGGAGTTTAACAGTTTGATTAGACTCTTGAGGCCTAAAGTCTACATCACTGACAGTTCAAGCTTCAAGACACTAGTGCAAGACCTCACCGGCAATGGAAGCTCAAATATCTCAATTACTACTTCCTCATCACACCCTCAGCAACAGCACAGAGTACCAGTTGTAGATGTTGAGGAGTATCAAGTAGAGCCTGAAAGGAGTACTAGTGTGGATGTCTCAACTAATGCATCATTTGATTCTTCTGAGCTGTGGAACCAAGAAATGTTTATACATGACCAAGAATTAAACCAACTGTGTTATCAGATGTATTCAGATGATACTACAACAACAAATATTTTAGAAGGTTCATCACCTTCAACAGTAGACCAAATGGTGGATTTGCCATTTCAAGATCTTGAGTCATGGCTTTCGGGGATTGAGCCTTTTGATCCTTTCAACATTAATGGTTATGGTCAGATTGATCAAGAGTGTCAGTCTGCAGTTGAGGAATCAACTTCCGCTAAACTTGAATCAAATTTCCACATGCAACCAAGATTGGTGAAAATTATGTTCTTGAAATGGGATATAGTAATTGGTTTTGGGGCTACTAGCCCAAGTTGCGAGAGAAGGTGGAAAGTAAGTTGGGCCAGAAATGCTTGTTCTAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
VQ

Protein Analysis

232

Amino Acids

26.28

Weight (kDa)

4.89

Isoelectric Point (pI)

58.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
VQ PF05678 29 - 51 9.4e-06 VQ motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 424
AccI GTMKAC 2 cut(s) 93, 414
AciI CCGC 1 cut(s) 549
AclWI GGATC 1 cut(s) 473
AcsI RAATTY 1 cut(s) 565
AfaI GTAC 2 cut(s) 207, 253
AfiI CCNNNNNNNGG 1 cut(s) 424
AgsI TTSAA 7 cut(s) 111, 118, 408, 440, 487, 560, 607
AhlI ACTAGT 2 cut(s) 124, 254
AluBI AGCT 3 cut(s) 114, 153, 298
AluI AGCT 3 cut(s) 114, 153, 298
Alw26I GTCTC 1 cut(s) 271
AlwI GGATC 1 cut(s) 473
AoxI GGCC 2 cut(s) 83, 675
ApoI RAATTY 1 cut(s) 565
AseI ATTAAT 1 cut(s) 492
AspS9I GGNCC 1 cut(s) 675
AsuHPI GGTGA 3 cut(s) 130, 393, 601
BbvCI CCTCAGC 1 cut(s) 189
BclI TGATCA 1 cut(s) 511
BcoDI GTCTC 1 cut(s) 271
BcuI ACTAGT 2 cut(s) 124, 254
BfaI CTAG 3 cut(s) 125, 255, 639
BfmI CTRYAG 1 cut(s) 528
BglII AGATCT 1 cut(s) 442
BmcAI AGTACT 1 cut(s) 253
BmgT120I GGNCC 1 cut(s) 675
BmiI GGNNCC 1 cut(s) 305
BmsI GCATC 1 cut(s) 287
Bpu10I CCTNAGC 1 cut(s) 189
BpuEI CTTGAG 2 cut(s) 100, 467
BsaXI ACNNNNNCTCC 2 cut(s) 241, 271
Bsc4I CCNNNNNNNGG 1 cut(s) 424
Bse118I RCCGGY 1 cut(s) 140
Bse1I ACTGG 1 cut(s) 209
Bse3DI GCAATG 1 cut(s) 151
BseGI GGATG 1 cut(s) 268
BseLI CCNNNNNNNGG 1 cut(s) 424
BseMI GCAATG 1 cut(s) 151
BseMII CTCAG 2 cut(s) 203, 285
BseNI ACTGG 1 cut(s) 209
BseRI GAGGAG 1 cut(s) 239
BshFI GGCC 2 cut(s) 85, 677
BsiSI CCGG 1 cut(s) 141
BslI CCNNNNNNNGG 1 cut(s) 424
BsmAI GTCTC 1 cut(s) 271
BsnI GGCC 2 cut(s) 85, 677
Bsp143I GATC 3 cut(s) 442, 478, 511
BspACI CCGC 1 cut(s) 549
BspANI GGCC 2 cut(s) 85, 677
BspCNI CTCAG 2 cut(s) 202, 286
BspLI GGNNCC 1 cut(s) 305
BspMAI CTGCAG 1 cut(s) 532
BspPI GGATC 1 cut(s) 473
BsrDI GCAATG 1 cut(s) 151
BsrFI RCCGGY 1 cut(s) 140
BsrI ACTGG 1 cut(s) 209
BssAI RCCGGY 1 cut(s) 140
BssMI GATC 3 cut(s) 442, 478, 511
Bst4CI ACNGT 4 cut(s) 65, 107, 345, 412
BstDEI CTNAG 3 cut(s) 39, 189, 294
BstF5I GGATG 1 cut(s) 268
BstKTI GATC 3 cut(s) 445, 481, 514
BstMAI GTCTC 1 cut(s) 271
BstMBI GATC 3 cut(s) 442, 478, 511
BstMWI GCNNNNNNNGC 3 cut(s) 150, 648, 683
BstNSI RCATGY 1 cut(s) 577
BstSFI CTRYAG 1 cut(s) 528
BstX2I RGATCY 1 cut(s) 442
BstYI RGATCY 1 cut(s) 442
BsuRI GGCC 2 cut(s) 85, 677
BtsCI GGATG 1 cut(s) 268
BtsIMutI CAGTG 2 cut(s) 33, 99
Cfr10I RCCGGY 1 cut(s) 140
Cfr13I GGNCC 1 cut(s) 675
Csp6I GTAC 2 cut(s) 206, 252
CviAII CATG 3 cut(s) 323, 453, 574
CviQI GTAC 2 cut(s) 206, 252
DdeI CTNAG 3 cut(s) 39, 189, 294
DpnI GATC 3 cut(s) 444, 480, 513
DpnII GATC 3 cut(s) 442, 478, 511
Eco147I AGGCCT 1 cut(s) 85
EcoT22I ATGCAT 1 cut(s) 280
FaeI CATG 3 cut(s) 326, 456, 577
FaiI YATR 7 cut(s) 320, 324, 454, 501, 575, 599, 617
FatI CATG 3 cut(s) 322, 452, 573
FbaI TGATCA 1 cut(s) 511
FblI GTMKAC 2 cut(s) 93, 414
FokI GGATG 1 cut(s) 275
FspBI CTAG 3 cut(s) 125, 255, 639
HaeIII GGCC 2 cut(s) 85, 677
HapII CCGG 1 cut(s) 141
Hin1II CATG 3 cut(s) 326, 456, 577
HindIII AAGCTT 1 cut(s) 112
HinfI GANTC 5 cut(s) 75, 287, 449, 539, 560
HpaII CCGG 1 cut(s) 141
HphI GGTGA 3 cut(s) 130, 393, 601
Hpy166II GTNNAC 2 cut(s) 94, 415
Hpy188I TCNGA 4 cut(s) 295, 354, 364, 507
Hpy188III TCNNGA 6 cut(s) 79, 118, 440, 446, 515, 604
Hpy8I GTNNAC 2 cut(s) 94, 415
HpyAV CCTTC 5 cut(s) 37, 46, 386, 414, 651
HpyCH4III ACNGT 4 cut(s) 65, 107, 345, 412
HpyCH4V TGCA 4 cut(s) 130, 278, 530, 577
HpyF10VI GCNNNNNNNGC 3 cut(s) 150, 648, 683
HpyF3I CTNAG 3 cut(s) 39, 189, 294
Hsp92II CATG 3 cut(s) 326, 456, 577
Ksp22I TGATCA 1 cut(s) 511
Kzo9I GATC 3 cut(s) 442, 478, 511
LpnPI CCDG 5 cut(s) 32, 154, 222, 255, 691
LweI GCATC 1 cut(s) 287
MaeI CTAG 3 cut(s) 125, 255, 639
MalI GATC 3 cut(s) 444, 480, 513
MboI GATC 3 cut(s) 442, 478, 511
MboII GAAGA 3 cut(s) 19, 61, 282
MflI RGATCY 1 cut(s) 442
MluCI AATT 5 cut(s) 165, 332, 565, 594, 621
MlyI GAGTC 2 cut(s) 69, 458
MnlI CCTC 6 cut(s) 75, 146, 187, 198, 217, 529
Mph1103I ATGCAT 1 cut(s) 280
MseI TTAA 3 cut(s) 60, 335, 492
MspI CCGG 1 cut(s) 141
MwoI GCNNNNNNNGC 3 cut(s) 150, 648, 683
NdeII GATC 3 cut(s) 442, 478, 511
NlaIII CATG 3 cut(s) 326, 456, 577
NlaIV GGNNCC 1 cut(s) 305
NsiI ATGCAT 1 cut(s) 280
NspI RCATGY 1 cut(s) 577
PceI AGGCCT 1 cut(s) 85
PfeI GAWTC 3 cut(s) 287, 539, 560
PflMI CCANNNNNTGG 1 cut(s) 424
PleI GAGTC 2 cut(s) 69, 457
PpsI GAGTC 2 cut(s) 69, 457
PshBI ATTAAT 1 cut(s) 492
PspN4I GGNNCC 1 cut(s) 305
PspPI GGNCC 1 cut(s) 675
PstI CTGCAG 1 cut(s) 532
PsuI RGATCY 1 cut(s) 442
RsaI GTAC 2 cut(s) 207, 253
RsaNI GTAC 2 cut(s) 206, 252
SaqAI TTAA 3 cut(s) 60, 335, 492
Sau3AI GATC 3 cut(s) 442, 478, 511
Sau96I GGNCC 1 cut(s) 675
ScaI AGTACT 1 cut(s) 253
SchI GAGTC 2 cut(s) 69, 458
SetI ASST 7 cut(s) 116, 138, 155, 300, 397, 406, 662
SfaNI GCATC 1 cut(s) 287
SfcI CTRYAG 1 cut(s) 528
SmlI CTYRAG 2 cut(s) 79, 446
SmoI CTYRAG 2 cut(s) 79, 446
SpeI ACTAGT 2 cut(s) 124, 254
Sse9I AATT 5 cut(s) 165, 332, 565, 594, 621
SseBI AGGCCT 1 cut(s) 85
SsiI CCGC 1 cut(s) 549
SspI AATATT 1 cut(s) 385
SspMI CTAG 3 cut(s) 125, 255, 639
StuI AGGCCT 1 cut(s) 85
TaaI ACNGT 4 cut(s) 65, 107, 345, 412
TasI AATT 5 cut(s) 165, 332, 565, 594, 621
TatI WGTACW 1 cut(s) 251
TfiI GAWTC 3 cut(s) 287, 539, 560
Tru1I TTAA 3 cut(s) 60, 335, 492
Tru9I TTAA 3 cut(s) 60, 335, 492
TscAI CASTG 2 cut(s) 33, 106
TspDTI ATGAA 1 cut(s) 387
TspRI CASTG 2 cut(s) 33, 106
Van91I CCANNNNNTGG 1 cut(s) 424
VspI ATTAAT 1 cut(s) 492
XapI RAATTY 1 cut(s) 565
XceI RCATGY 1 cut(s) 577
XmiI GTMKAC 2 cut(s) 93, 414
XspI CTAG 3 cut(s) 125, 255, 639
ZrmI AGTACT 1 cut(s) 253
Zsp2I ATGCAT 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.