Rmu_sc0000021.1_g000006

VQ motif

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000021.1
OG0004850
Physical Location & Seq
Forward (+)
39028 .. 39603
576 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000021.1_g000006.1.cds

Sequence Viewer

Length: 576 bp
atgaaagtaagccaaacatcagtgaaaatatcaaagaaagaaaagaaggaacttaacagtttgataagactcttgaagccaaaagtctacatcactgacagctcaagcttcaagatgcttgtacaagacctcaccggaaagggaagctcaaacatttcaatcactacttcctcatcacaccccaagatacaacaacacaaagtacttgttgaggaagaggaaataccagttgtaaatattgaggaggatcaaggagagcctcaagggagtactagtgtggatgtgtcaactgatgcatcattagatgcttccgagctattcaacaaagatgttttgctgaatgaccaagaattgaatcaaatatattatcagacgtattcagatgctacaacaactactactactttagaaggttctaattcgacagtggaccaattggtggatatgttaccttttcaagatcttgagtcatggctgcttttaggtactgagccttttgattctttcaacaatagttatactcagatttttcaagagttcagcggaaacgactatgacctgtcggggatactatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
VQ

Protein Analysis

191

Amino Acids

21.32

Weight (kDa)

4.32

Isoelectric Point (pI)

45.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 439
AccI GTMKAC 1 cut(s) 87
AciI CCGC 1 cut(s) 543
AclWI GGATC 1 cut(s) 255
AfaI GTAC 4 cut(s) 123, 204, 271, 487
AfiI CCNNNNNNNGG 1 cut(s) 439
AgsI TTSAA 8 cut(s) 76, 112, 159, 322, 355, 458, 508, 533
AhlI ACTAGT 1 cut(s) 272
AluBI AGCT 4 cut(s) 102, 108, 147, 316
AluI AGCT 4 cut(s) 102, 108, 147, 316
AlwI GGATC 1 cut(s) 255
ApeKI GCWGC 1 cut(s) 475
AspS9I GGNCC 1 cut(s) 430
AsuHPI GGTGA 1 cut(s) 124
AvaII GGWCC 1 cut(s) 430
BarI GAAGNNNNNNTAC 2 cut(s) 207, 239
BbvI GCAGC 1 cut(s) 462
BciVI GTATCC 1 cut(s) 561
BcuI ACTAGT 1 cut(s) 272
BfaI CTAG 1 cut(s) 273
BfuI GTATCC 1 cut(s) 561
BglII AGATCT 1 cut(s) 460
BisI GCNGC 1 cut(s) 476
BlsI GCNGC 1 cut(s) 477
BmcAI AGTACT 2 cut(s) 204, 271
Bme18I GGWCC 1 cut(s) 430
BmgT120I GGNCC 1 cut(s) 430
BmsI GCATC 5 cut(s) 105, 283, 295, 305, 373
BpuEI CTTGAG 3 cut(s) 88, 246, 485
BsaWI WCCGGW 1 cut(s) 134
BsaXI ACNNNNNCTCC 2 cut(s) 259, 289
Bsc4I CCNNNNNNNGG 1 cut(s) 439
Bse1I ACTGG 1 cut(s) 227
BseGI GGATG 1 cut(s) 286
BseLI CCNNNNNNNGG 1 cut(s) 439
BseMII CTCAG 2 cut(s) 480, 536
BseNI ACTGG 1 cut(s) 227
BseRI GAGGAG 1 cut(s) 257
BseXI GCAGC 1 cut(s) 462
BsiSI CCGG 1 cut(s) 135
BslI CCNNNNNNNGG 1 cut(s) 439
Bsp1407I TGTACA 1 cut(s) 121
Bsp143I GATC 2 cut(s) 247, 460
BspACI CCGC 1 cut(s) 543
BspCNI CTCAG 2 cut(s) 481, 535
BspPI GGATC 1 cut(s) 255
BsrGI TGTACA 1 cut(s) 121
BsrI ACTGG 1 cut(s) 227
BssMI GATC 2 cut(s) 247, 460
Bst4CI ACNGT 2 cut(s) 59, 427
Bst6I CTCTTC 1 cut(s) 210
BstAUI TGTACA 1 cut(s) 121
BstDEI CTNAG 2 cut(s) 489, 522
BstF5I GGATG 1 cut(s) 286
BstKTI GATC 2 cut(s) 250, 463
BstMBI GATC 2 cut(s) 247, 460
BstV1I GCAGC 1 cut(s) 462
BstX2I RGATCY 1 cut(s) 460
BstYI RGATCY 1 cut(s) 460
BsuI GTATCC 1 cut(s) 561
BtsCI GGATG 1 cut(s) 286
BtsIMutI CAGTG 3 cut(s) 27, 93, 432
Cfr13I GGNCC 1 cut(s) 430
Csp6I GTAC 4 cut(s) 122, 203, 270, 486
CviAII CATG 1 cut(s) 471
CviJI RGCY 9 cut(s) 12, 79, 102, 108, 147, 259, 316, 475, 493
CviKI_1 RGCY 9 cut(s) 12, 79, 102, 108, 147, 259, 316, 475, 493
CviQI GTAC 4 cut(s) 122, 203, 270, 486
DdeI CTNAG 2 cut(s) 489, 522
DpnI GATC 2 cut(s) 249, 462
DpnII GATC 2 cut(s) 247, 460
Eam1104I CTCTTC 1 cut(s) 210
EarI CTCTTC 1 cut(s) 210
Eco47I GGWCC 1 cut(s) 430
EcoT22I ATGCAT 1 cut(s) 298
FaeI CATG 1 cut(s) 474
FaiI YATR 6 cut(s) 364, 446, 472, 519, 555, 574
FatI CATG 1 cut(s) 470
FblI GTMKAC 1 cut(s) 87
Fnu4HI GCNGC 1 cut(s) 476
FokI GGATG 1 cut(s) 293
Fsp4HI GCNGC 1 cut(s) 476
FspBI CTAG 1 cut(s) 273
GluI GCNGC 1 cut(s) 476
HapII CCGG 1 cut(s) 135
Hin1II CATG 1 cut(s) 474
HincII GTYRAC 1 cut(s) 288
HindII GTYRAC 1 cut(s) 288
HindIII AAGCTT 1 cut(s) 106
HinfI GANTC 4 cut(s) 69, 355, 467, 500
HpaII CCGG 1 cut(s) 135
HphI GGTGA 1 cut(s) 124
Hpy166II GTNNAC 3 cut(s) 88, 288, 430
Hpy188I TCNGA 4 cut(s) 313, 372, 382, 525
Hpy188III TCNNGA 5 cut(s) 73, 112, 458, 464, 533
Hpy8I GTNNAC 3 cut(s) 88, 288, 430
HpyAV CCTTC 2 cut(s) 40, 404
HpyCH4III ACNGT 2 cut(s) 59, 427
HpyCH4IV ACGT 1 cut(s) 374
HpyCH4V TGCA 1 cut(s) 296
HpyF3I CTNAG 2 cut(s) 489, 522
HpySE526I ACGT 1 cut(s) 374
Hsp92II CATG 1 cut(s) 474
Kzo9I GATC 2 cut(s) 247, 460
LpnPI CCDG 3 cut(s) 148, 240, 572
Lsp1109I GCAGC 1 cut(s) 462
LweI GCATC 5 cut(s) 105, 283, 295, 305, 373
MaeI CTAG 1 cut(s) 273
MaeII ACGT 1 cut(s) 374
MaeIII GTNAC 1 cut(s) 447
MalI GATC 2 cut(s) 249, 462
MboI GATC 2 cut(s) 247, 460
MboII GAAGA 1 cut(s) 227
MfeI CAATTG 1 cut(s) 434
MflI RGATCY 1 cut(s) 460
MluCI AATT 3 cut(s) 350, 418, 434
MlyI GAGTC 2 cut(s) 63, 476
MnlI CCTC 7 cut(s) 140, 181, 205, 211, 235, 238, 270
Mph1103I ATGCAT 1 cut(s) 298
MseI TTAA 1 cut(s) 54
MspA1I CMGCKG 1 cut(s) 543
MspI CCGG 1 cut(s) 135
MunI CAATTG 1 cut(s) 434
NdeII GATC 2 cut(s) 247, 460
NlaIII CATG 1 cut(s) 474
NsiI ATGCAT 1 cut(s) 298
PfeI GAWTC 2 cut(s) 355, 500
PflMI CCANNNNNTGG 1 cut(s) 439
PkrI GCNGC 1 cut(s) 477
PleI GAGTC 2 cut(s) 63, 475
PpsI GAGTC 2 cut(s) 63, 475
PspPI GGNCC 1 cut(s) 430
PsuI RGATCY 1 cut(s) 460
RsaI GTAC 4 cut(s) 123, 204, 271, 487
RsaNI GTAC 4 cut(s) 122, 203, 270, 486
SaqAI TTAA 1 cut(s) 54
SatI GCNGC 1 cut(s) 476
Sau3AI GATC 2 cut(s) 247, 460
Sau96I GGNCC 1 cut(s) 430
ScaI AGTACT 2 cut(s) 204, 271
SchI GAGTC 2 cut(s) 63, 476
SfaNI GCATC 5 cut(s) 105, 283, 295, 305, 373
SinI GGWCC 1 cut(s) 430
SmlI CTYRAG 3 cut(s) 103, 261, 464
SmoI CTYRAG 3 cut(s) 103, 261, 464
SpeI ACTAGT 1 cut(s) 272
Sse9I AATT 3 cut(s) 350, 418, 434
SsiI CCGC 1 cut(s) 543
SspI AATATT 1 cut(s) 238
SspMI CTAG 1 cut(s) 273
TaaI ACNGT 2 cut(s) 59, 427
TaiI ACGT 1 cut(s) 377
TaqI TCGA 1 cut(s) 422
TasI AATT 3 cut(s) 350, 418, 434
TatI WGTACW 3 cut(s) 121, 202, 269
TfiI GAWTC 2 cut(s) 355, 500
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TscAI CASTG 3 cut(s) 27, 100, 432
TseI GCWGC 1 cut(s) 475
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 3 cut(s) 27, 100, 432
Van91I CCANNNNNTGG 1 cut(s) 439
VpaK11BI GGWCC 1 cut(s) 430
XmiI GTMKAC 1 cut(s) 87
XspI CTAG 1 cut(s) 273
ZrmI AGTACT 2 cut(s) 204, 271
Zsp2I ATGCAT 1 cut(s) 298
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.