RLG00000020582

VQ motif

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
Physical Location & Seq
Forward (+)
66447341 .. 66447898
558 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000020582

Sequence Viewer

Length: 558 bp
ATGGGGAAGAAAGTGAGCCAGACATCAGTGAAAATATCTAAGAAGGAGAAGAAGGAGTTTAACAGTTTGATTAGACTCTTGAGGCCTAAAGTCTACATCACTGACTGCTCAAGCTTCAAGACACTAGTGCAAGACCTCACTGGCAATGGAAGCTCAAATATCTCAATTACTACTTCCTCATCACACCCTCAGCAACAGCACAGAGTACCAGTTGTAGATGTTGAGGAGTATCAAGTAGAGCCTGAAAGGAGTACTAGTGTGGATGTCTCAACTGATGCATCATTTGATTCTTCTGAGCTGTGGAACCAAGAAATGTTTATACATGACCAAGAATTAAACCAACTGTGTTATCAGATGTATTCAGATGATACTACAACAACAAATATTTTAGAAGGTTCATCACCAACAGCAGACCAAATGGTGGATATGTTGCCATTTCAAGATCTTGAGTCATGGCTTTCGGGGACTGAGCCTTTTGATCCTTTCAACATTAATGGTTATGGTCAGATTGATCAAGGGGTCAGCATATTTGACTATGAGCTGTCAGGGCTACTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

186

Amino Acids

20.85

Weight (kDa)

4.37

Isoelectric Point (pI)

47.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 421
AccI GTMKAC 1 cut(s) 93
AclWI GGATC 1 cut(s) 473
AfaI GTAC 2 cut(s) 207, 253
AfiI CCNNNNNNNGG 1 cut(s) 421
AgsI TTSAA 3 cut(s) 118, 440, 487
AhlI ACTAGT 2 cut(s) 124, 254
AluBI AGCT 4 cut(s) 114, 153, 298, 541
AluI AGCT 4 cut(s) 114, 153, 298, 541
Alw26I GTCTC 1 cut(s) 271
AlwI GGATC 1 cut(s) 473
AoxI GGCC 1 cut(s) 83
AseI ATTAAT 1 cut(s) 492
AsuHPI GGTGA 1 cut(s) 393
BbvCI CCTCAGC 1 cut(s) 189
BclI TGATCA 1 cut(s) 511
BcoDI GTCTC 1 cut(s) 271
BcuI ACTAGT 2 cut(s) 124, 254
BfaI CTAG 2 cut(s) 125, 255
BglII AGATCT 1 cut(s) 442
BmcAI AGTACT 1 cut(s) 253
BmiI GGNNCC 1 cut(s) 305
BmsI GCATC 2 cut(s) 265, 287
Bpu10I CCTNAGC 1 cut(s) 189
BpuEI CTTGAG 3 cut(s) 94, 100, 467
BsaXI ACNNNNNCTCC 2 cut(s) 241, 271
Bsc4I CCNNNNNNNGG 1 cut(s) 421
Bse1I ACTGG 2 cut(s) 145, 209
Bse3DI GCAATG 1 cut(s) 151
BseGI GGATG 1 cut(s) 268
BseLI CCNNNNNNNGG 1 cut(s) 421
BseMI GCAATG 1 cut(s) 151
BseMII CTCAG 3 cut(s) 203, 285, 459
BseNI ACTGG 2 cut(s) 145, 209
BseRI GAGGAG 1 cut(s) 239
BshFI GGCC 1 cut(s) 85
BslFI GGGAC 1 cut(s) 478
BslI CCNNNNNNNGG 1 cut(s) 421
BsmAI GTCTC 1 cut(s) 271
BsmFI GGGAC 1 cut(s) 478
BsnI GGCC 1 cut(s) 85
Bsp143I GATC 3 cut(s) 442, 478, 511
BspANI GGCC 1 cut(s) 85
BspCNI CTCAG 3 cut(s) 202, 286, 460
BspLI GGNNCC 1 cut(s) 305
BspPI GGATC 1 cut(s) 473
BsrDI GCAATG 1 cut(s) 151
BsrI ACTGG 2 cut(s) 145, 209
BssMI GATC 3 cut(s) 442, 478, 511
Bst4CI ACNGT 2 cut(s) 65, 345
BstDEI CTNAG 4 cut(s) 39, 189, 294, 468
BstF5I GGATG 1 cut(s) 268
BstKTI GATC 3 cut(s) 445, 481, 514
BstMAI GTCTC 1 cut(s) 271
BstMBI GATC 3 cut(s) 442, 478, 511
BstMWI GCNNNNNNNGC 2 cut(s) 150, 547
BstX2I RGATCY 1 cut(s) 442
BstYI RGATCY 1 cut(s) 442
BsuRI GGCC 1 cut(s) 85
BtsCI GGATG 1 cut(s) 268
BtsIMutI CAGTG 3 cut(s) 33, 99, 138
Csp6I GTAC 2 cut(s) 206, 252
CviAII CATG 2 cut(s) 323, 453
CviQI GTAC 2 cut(s) 206, 252
DdeI CTNAG 4 cut(s) 39, 189, 294, 468
DpnI GATC 3 cut(s) 444, 480, 513
DpnII GATC 3 cut(s) 442, 478, 511
Eco147I AGGCCT 1 cut(s) 85
EcoT22I ATGCAT 1 cut(s) 280
FaeI CATG 2 cut(s) 326, 456
FaiI YATR 8 cut(s) 320, 324, 428, 454, 501, 527, 537, 556
FaqI GGGAC 1 cut(s) 478
FatI CATG 2 cut(s) 322, 452
FbaI TGATCA 1 cut(s) 511
FblI GTMKAC 1 cut(s) 93
FokI GGATG 1 cut(s) 275
FspBI CTAG 2 cut(s) 125, 255
HaeIII GGCC 1 cut(s) 85
Hin1II CATG 2 cut(s) 326, 456
HindIII AAGCTT 1 cut(s) 112
HinfI GANTC 3 cut(s) 75, 287, 449
HphI GGTGA 1 cut(s) 393
Hpy166II GTNNAC 1 cut(s) 94
Hpy188I TCNGA 4 cut(s) 295, 354, 364, 507
Hpy188III TCNNGA 4 cut(s) 79, 118, 440, 446
Hpy8I GTNNAC 1 cut(s) 94
HpyAV CCTTC 3 cut(s) 37, 46, 386
HpyCH4III ACNGT 2 cut(s) 65, 345
HpyCH4V TGCA 2 cut(s) 130, 278
HpyF10VI GCNNNNNNNGC 2 cut(s) 150, 547
HpyF3I CTNAG 4 cut(s) 39, 189, 294, 468
Hsp92II CATG 2 cut(s) 326, 456
Ksp22I TGATCA 1 cut(s) 511
Kzo9I GATC 3 cut(s) 442, 478, 511
LpnPI CCDG 5 cut(s) 32, 126, 222, 255, 531
LweI GCATC 2 cut(s) 265, 287
MaeI CTAG 2 cut(s) 125, 255
MalI GATC 3 cut(s) 444, 480, 513
MboI GATC 3 cut(s) 442, 478, 511
MboII GAAGA 3 cut(s) 19, 61, 282
MflI RGATCY 1 cut(s) 442
MluCI AATT 2 cut(s) 165, 332
MlyI GAGTC 2 cut(s) 69, 458
MnlI CCTC 5 cut(s) 75, 146, 187, 198, 217
Mph1103I ATGCAT 1 cut(s) 280
MseI TTAA 3 cut(s) 60, 335, 492
MwoI GCNNNNNNNGC 2 cut(s) 150, 547
NdeII GATC 3 cut(s) 442, 478, 511
NlaIII CATG 2 cut(s) 326, 456
NlaIV GGNNCC 1 cut(s) 305
NsiI ATGCAT 1 cut(s) 280
PceI AGGCCT 1 cut(s) 85
PfeI GAWTC 1 cut(s) 287
PflMI CCANNNNNTGG 1 cut(s) 421
PleI GAGTC 2 cut(s) 69, 457
PpsI GAGTC 2 cut(s) 69, 457
PshBI ATTAAT 1 cut(s) 492
PspN4I GGNNCC 1 cut(s) 305
PsuI RGATCY 1 cut(s) 442
RsaI GTAC 2 cut(s) 207, 253
RsaNI GTAC 2 cut(s) 206, 252
SaqAI TTAA 3 cut(s) 60, 335, 492
Sau3AI GATC 3 cut(s) 442, 478, 511
ScaI AGTACT 1 cut(s) 253
SchI GAGTC 2 cut(s) 69, 458
SetI ASST 6 cut(s) 116, 138, 155, 300, 397, 543
SfaNI GCATC 2 cut(s) 265, 287
SmlI CTYRAG 3 cut(s) 79, 109, 446
SmoI CTYRAG 3 cut(s) 79, 109, 446
SpeI ACTAGT 2 cut(s) 124, 254
Sse9I AATT 2 cut(s) 165, 332
SseBI AGGCCT 1 cut(s) 85
SspI AATATT 1 cut(s) 385
SspMI CTAG 2 cut(s) 125, 255
StuI AGGCCT 1 cut(s) 85
TaaI ACNGT 2 cut(s) 65, 345
TasI AATT 2 cut(s) 165, 332
TatI WGTACW 1 cut(s) 251
TfiI GAWTC 1 cut(s) 287
Tru1I TTAA 3 cut(s) 60, 335, 492
Tru9I TTAA 3 cut(s) 60, 335, 492
TscAI CASTG 3 cut(s) 33, 106, 145
TspDTI ATGAA 1 cut(s) 387
TspRI CASTG 3 cut(s) 33, 106, 145
Van91I CCANNNNNTGG 1 cut(s) 421
VspI ATTAAT 1 cut(s) 492
XmiI GTMKAC 1 cut(s) 93
XspI CTAG 2 cut(s) 125, 255
ZrmI AGTACT 1 cut(s) 253
Zsp2I ATGCAT 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.