Prupe.5G224300_v2.0.a1

Nonspecific lipid-transfer protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
Physical Location & Seq
Reverse (-)
17383818 .. 17384125
308 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G224300.1

Sequence Viewer

Length: 291 bp
ATGAAGGCATCATATTCATACATTGCAATTGCATTGTACCTTGTGGTTGTGGTGCTGTTGGGCAAAGCAGATGTTTCAATGGCAGTAACATGCAACCCAACAGAACTAAGTCCCTGTGCAGGAGCAATAACTTCTTCAACTCCTCCATCCACAATATGCTGCACCAAGATCAAGCAACAGAAGCCCTGCCTCTGCCAGTATCTCAACAACCCCAACCTCAAGAAGTTTGTCAACACCCCAAATGCCAGGAAAGTTGCTAGGACTTGTGGCACTCCTTTCCCCAAGTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.3

Weight (kDa)

9.36

Isoelectric Point (pI)

24.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 38
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 2 cut(s) 78, 138
AjnI CCWGG 1 cut(s) 245
ApeKI GCWGC 1 cut(s) 159
BbvI GCAGC 1 cut(s) 146
BccI CCATC 1 cut(s) 154
BciT130I CCWGG 1 cut(s) 247
BfaI CTAG 2 cut(s) 258, 289
BisI GCNGC 1 cut(s) 160
BlsI GCNGC 1 cut(s) 161
Bme1390I CCNGG 1 cut(s) 247
BmrFI CCNGG 1 cut(s) 247
BmsI GCATC 1 cut(s) 17
BpuEI CTTGAG 1 cut(s) 203
Bsc4I CCNNNNNNNGG 1 cut(s) 119
Bse1I ACTGG 1 cut(s) 196
Bse3DI GCAATG 1 cut(s) 21
BseBI CCWGG 1 cut(s) 247
BseGI GGATG 1 cut(s) 146
BseLI CCNNNNNNNGG 1 cut(s) 119
BseMI GCAATG 1 cut(s) 21
BseNI ACTGG 1 cut(s) 196
BseRI GAGGAG 1 cut(s) 132
BseXI GCAGC 1 cut(s) 146
BsgI GTGCAG 2 cut(s) 138, 145
BslFI GGGAC 1 cut(s) 96
BslI CCNNNNNNNGG 1 cut(s) 119
BsmFI GGGAC 1 cut(s) 96
Bsp143I GATC 1 cut(s) 168
BsrDI GCAATG 1 cut(s) 21
BsrI ACTGG 1 cut(s) 196
BssMI GATC 1 cut(s) 168
Bst2UI CCWGG 1 cut(s) 247
BstDEI CTNAG 1 cut(s) 107
BstF5I GGATG 1 cut(s) 146
BstKTI GATC 1 cut(s) 171
BstMBI GATC 1 cut(s) 168
BstMWI GCNNNNNNNGC 1 cut(s) 181
BstNI CCWGG 1 cut(s) 247
BstNSI RCATGY 1 cut(s) 93
BstSCI CCNGG 1 cut(s) 245
BstV1I GCAGC 1 cut(s) 146
BtsCI GGATG 1 cut(s) 146
Csp6I GTAC 1 cut(s) 37
CviAII CATG 1 cut(s) 90
CviJI RGCY 1 cut(s) 184
CviKI_1 RGCY 1 cut(s) 184
CviQI GTAC 1 cut(s) 37
DdeI CTNAG 1 cut(s) 107
DpnI GATC 1 cut(s) 170
DpnII GATC 1 cut(s) 168
EcoRII CCWGG 1 cut(s) 245
FaeI CATG 1 cut(s) 93
FaiI YATR 4 cut(s) 13, 19, 91, 157
FaqI GGGAC 1 cut(s) 96
FatI CATG 1 cut(s) 89
Fnu4HI GCNGC 1 cut(s) 160
FokI GGATG 1 cut(s) 133
Fsp4HI GCNGC 1 cut(s) 160
FspBI CTAG 2 cut(s) 258, 289
GluI GCNGC 1 cut(s) 160
Hin1II CATG 1 cut(s) 93
HincII GTYRAC 1 cut(s) 232
HindII GTYRAC 1 cut(s) 232
Hpy166II GTNNAC 1 cut(s) 232
Hpy188III TCNNGA 1 cut(s) 220
Hpy8I GTNNAC 1 cut(s) 232
HpyCH4V TGCA 5 cut(s) 26, 32, 93, 119, 162
HpyF10VI GCNNNNNNNGC 1 cut(s) 181
HpyF3I CTNAG 1 cut(s) 107
Hsp92II CATG 1 cut(s) 93
Kzo9I GATC 1 cut(s) 168
LmnI GCTCC 1 cut(s) 122
LpnPI CCDG 6 cut(s) 105, 127, 199, 209, 232, 259
Lsp1109I GCAGC 1 cut(s) 146
LweI GCATC 1 cut(s) 17
MaeI CTAG 2 cut(s) 258, 289
MaeIII GTNAC 1 cut(s) 85
MalI GATC 1 cut(s) 170
MboI GATC 1 cut(s) 168
MboII GAAGA 1 cut(s) 126
MfeI CAATTG 1 cut(s) 27
MluCI AATT 1 cut(s) 27
MnlI CCTC 3 cut(s) 153, 200, 227
MspR9I CCNGG 1 cut(s) 247
MunI CAATTG 1 cut(s) 27
MvaI CCWGG 1 cut(s) 247
MwoI GCNNNNNNNGC 1 cut(s) 181
NdeII GATC 1 cut(s) 168
NlaIII CATG 1 cut(s) 93
NspI RCATGY 1 cut(s) 93
PkrI GCNGC 1 cut(s) 161
Psp6I CCWGG 1 cut(s) 245
PspGI CCWGG 1 cut(s) 245
RsaI GTAC 1 cut(s) 38
RsaNI GTAC 1 cut(s) 37
SatI GCNGC 1 cut(s) 160
Sau3AI GATC 1 cut(s) 168
ScrFI CCNGG 1 cut(s) 247
SetI ASST 2 cut(s) 42, 219
SfaNI GCATC 1 cut(s) 17
SmlI CTYRAG 1 cut(s) 218
SmoI CTYRAG 1 cut(s) 218
Sse9I AATT 1 cut(s) 27
SspMI CTAG 2 cut(s) 258, 289
StyD4I CCNGG 1 cut(s) 245
TasI AATT 1 cut(s) 27
TseI GCWGC 1 cut(s) 159
TspDTI ATGAA 2 cut(s) 6, 17
XceI RCATGY 1 cut(s) 93
XspI CTAG 2 cut(s) 258, 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.