Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr7C

Orthogroup ID

OG0004601

Physical Location & Seq

Genomic Coordinates Forward (+)

1751655 .. 1752271

Gene Structure 617 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh7CG025000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 381 bp

ATGCTGGCCACAGCAGAGGTGTCCATGGCAGCTGTGACTTGCAGCCCAGTAGAGCTGAGCTCCTGTGCAAGTGCAATAAGCTCTAATACTCCACCATCAAATCTATGCTGCACCAAAATCAAGGAGCAGAAGCCTTGTCTCTGCCAGTACCTCAACAACCCCAACCTCAAGAAATTCGTTAACACCCCGAATGCTCGGAGAGTTGCTAGGACTTGTGGCACTCCCTTCCCCAGGTGGTTCTTGTTGGAAGTCAGCATTTTCAGTCTCCTGAGTATTGCTGAATATGGTATCTACATTGCCCAAGCTAGCTCTGATCTTTATATCTGCAAATATTGCAGCCCAATATCAACTTATTCTAATGCCAGTCATAACCTGGCCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LTP_2

Protein Analysis

126

Amino Acids

13.72

Weight (kDa)

8.6

Isoelectric Point (pI)

40.02

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
LTP_2	PF14368	10 - 74	1.5e-08	Probable lipid transfer
Tryp_alpha_amyl	PF00234	18 - 78	7.4e-09	Protease inhibitor/seed storage/LTP family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004601)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G73780
malus_domestica	MD06G1219800.v1.1 MD13G1035400.v1.1 MD14G1229500.v1.1 MD15G1204900.v1.1 MD16G1037400.v1.1
prunus_persica	Prupe.1G316400_v2.0.a1 Prupe.5G224300_v2.0.a1
pyrus_communis	pycom06g19630 pycom13g03110 pycom14g19090 pycom16g03260
rosa_chinensis	RchiOBHm_Chr7g0179461 RchiOBHm_Chr7g0179471
rosa_laevigata	RLG00000005353 RLG00000005354
rosa_multiflora	Rmu_sc0000735.1_g000021 Rmu_sc0000735.1_g000023
rosa_roxburghii	Rroxscaffold_3G00273980 Rroxscaffold_3G00273990
rosa_rugosa	Rorug06G0424700
rosa_samantha	Rh7AG024000 Rh7AG024300 Rh7BG023600 Rh7BG023700 Rh7CG025000 Rh7CG025100 Rh7DG024500 Rh7DG024600
rosa_wichuraiana	Rw7G001950 Rw7G001960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	6
AcsI	RAATTY	1 cut(s)	173
AfaI	GTAC	1 cut(s)	149
AfiI	CCNNNNNNNGG	1 cut(s)	231
AjnI	CCWGG	2 cut(s)	230, 372
AluBI	AGCT	6 cut(s)	32, 55, 60, 81, 305, 309
AluI	AGCT	6 cut(s)	32, 55, 60, 81, 305, 309
Alw21I	GWGCWC	1 cut(s)	62
Alw26I	GTCTC	2 cut(s)	143, 269
AoxI	GGCC	2 cut(s)	6, 375
ApeKI	GCWGC	4 cut(s)	29, 42, 108, 336
ApoI	RAATTY	1 cut(s)	173
AsuNHI	GCTAGC	1 cut(s)	305
BalI	TGGCCA	1 cut(s)	8
BanII	GRGCYC	1 cut(s)	62
Bbv12I	GWGCWC	1 cut(s)	62
BbvI	GCAGC	4 cut(s)	41, 54, 95, 348
BccI	CCATC	1 cut(s)	103
BciT130I	CCWGG	2 cut(s)	232, 374
BcoDI	GTCTC	2 cut(s)	143, 269
BfaI	CTAG	2 cut(s)	207, 306
BisI	GCNGC	4 cut(s)	30, 43, 109, 337
BlpI	GCTNAGC	1 cut(s)	56
BlsI	GCNGC	4 cut(s)	31, 44, 110, 338
Bme1390I	CCNGG	2 cut(s)	232, 374
BmrFI	CCNGG	2 cut(s)	232, 374
BmrI	ACTGGG	1 cut(s)	41
BmtI	GCTAGC	1 cut(s)	309
BmuI	ACTGGG	1 cut(s)	41
BplI	GAGNNNNNCTC	2 cut(s)	44, 76
Bpu1102I	GCTNAGC	1 cut(s)	56
BpuEI	CTTGAG	1 cut(s)	152
BsaJI	CCNNGG	2 cut(s)	24, 230
Bsc4I	CCNNNNNNNGG	1 cut(s)	231
Bse1I	ACTGG	3 cut(s)	47, 145, 363
Bse3DI	GCAATG	1 cut(s)	294
BseBI	CCWGG	2 cut(s)	232, 374
BseDI	CCNNGG	2 cut(s)	24, 230
BseLI	CCNNNNNNNGG	1 cut(s)	231
BseMI	GCAATG	1 cut(s)	294
BseMII	CTCAG	2 cut(s)	47, 260
BseNI	ACTGG	3 cut(s)	47, 145, 363
BseXI	GCAGC	4 cut(s)	41, 54, 95, 348
BsgI	GTGCAG	1 cut(s)	94
BshFI	GGCC	2 cut(s)	8, 377
BsiHKAI	GWGCWC	1 cut(s)	62
BslI	CCNNNNNNNGG	1 cut(s)	231
BsmAI	GTCTC	2 cut(s)	143, 269
BsmI	GAATGC	1 cut(s)	196
BsnI	GGCC	2 cut(s)	8, 377
Bsp1286I	GDGCHC	1 cut(s)	62
Bsp143I	GATC	1 cut(s)	313
Bsp1720I	GCTNAGC	1 cut(s)	56
Bsp19I	CCATGG	1 cut(s)	24
BspANI	GGCC	2 cut(s)	8, 377
BspCNI	CTCAG	2 cut(s)	48, 261
BspOI	GCTAGC	1 cut(s)	309
BsrDI	GCAATG	1 cut(s)	294
BsrI	ACTGG	3 cut(s)	47, 145, 363
BssECI	CCNNGG	2 cut(s)	24, 230
BssMI	GATC	1 cut(s)	313
BssT1I	CCWWGG	1 cut(s)	24
Bst2UI	CCWGG	2 cut(s)	232, 374
BstAPI	GCANNNNNTGC	1 cut(s)	333
BstC8I	GCNNGC	2 cut(s)	6, 307
BstDEI	CTNAG	2 cut(s)	56, 269
BstDSI	CCRYGG	1 cut(s)	24
BstENI	CCTNNNNNAGG	1 cut(s)	229
BstKTI	GATC	1 cut(s)	316
BstMAI	GTCTC	2 cut(s)	143, 269
BstMBI	GATC	1 cut(s)	313
BstMWI	GCNNNNNNNGC	1 cut(s)	333
BstNI	CCWGG	2 cut(s)	232, 374
BstSCI	CCNGG	2 cut(s)	230, 372
BstV1I	GCAGC	4 cut(s)	41, 54, 95, 348
BsuRI	GGCC	2 cut(s)	8, 377
BtgI	CCRYGG	1 cut(s)	24
Cac8I	GCNNGC	2 cut(s)	6, 307
Csp6I	GTAC	1 cut(s)	148
CviAII	CATG	1 cut(s)	25
CviQI	GTAC	1 cut(s)	148
DdeI	CTNAG	2 cut(s)	56, 269
DpnI	GATC	1 cut(s)	315
DpnII	GATC	1 cut(s)	313
EaeI	YGGCCR	1 cut(s)	6
Ecl136II	GAGCTC	1 cut(s)	60
Eco130I	CCWWGG	1 cut(s)	24
Eco24I	GRGCYC	1 cut(s)	62
Eco53kI	GAGCTC	1 cut(s)	60
EcoICRI	GAGCTC	1 cut(s)	60
EcoNI	CCTNNNNNAGG	1 cut(s)	229
EcoRII	CCWGG	2 cut(s)	230, 372
EcoT14I	CCWWGG	1 cut(s)	24
EcoT38I	GRGCYC	1 cut(s)	62
ErhI	CCWWGG	1 cut(s)	24
FaeI	CATG	1 cut(s)	28
FaiI	YATR	5 cut(s)	26, 106, 285, 321, 369
FatI	CATG	1 cut(s)	24
Fnu4HI	GCNGC	4 cut(s)	30, 43, 109, 337
FriOI	GRGCYC	1 cut(s)	62
Fsp4HI	GCNGC	4 cut(s)	30, 43, 109, 337
FspBI	CTAG	2 cut(s)	207, 306
GluI	GCNGC	4 cut(s)	30, 43, 109, 337
HaeIII	GGCC	2 cut(s)	8, 377
Hin1II	CATG	1 cut(s)	28
HincII	GTYRAC	1 cut(s)	181
HindII	GTYRAC	1 cut(s)	181
HpaI	GTTAAC	1 cut(s)	181
Hpy166II	GTNNAC	1 cut(s)	181
Hpy188I	TCNGA	2 cut(s)	198, 313
Hpy188III	TCNNGA	2 cut(s)	169, 268
Hpy8I	GTNNAC	1 cut(s)	181
HpyAV	CCTTC	1 cut(s)	235
HpyCH4V	TGCA	6 cut(s)	42, 68, 74, 111, 327, 336
HpyF10VI	GCNNNNNNNGC	1 cut(s)	333
HpyF3I	CTNAG	2 cut(s)	56, 269
Hsp92II	CATG	1 cut(s)	28
KspAI	GTTAAC	1 cut(s)	181
Kzo9I	GATC	1 cut(s)	313
LmnI	GCTCC	2 cut(s)	65, 124
LpnPI	CCDG	8 cut(s)	60, 76, 158, 217, 244, 281, 359, 376
Lsp1109I	GCAGC	4 cut(s)	41, 54, 95, 348
MaeI	CTAG	2 cut(s)	207, 306
MaeIII	GTNAC	1 cut(s)	34
MalI	GATC	1 cut(s)	315
MboI	GATC	1 cut(s)	313
MhlI	GDGCHC	1 cut(s)	62
MlsI	TGGCCA	1 cut(s)	8
MluCI	AATT	1 cut(s)	173
MluNI	TGGCCA	1 cut(s)	8
MmeI	TCCRAC	1 cut(s)	225
MnlI	CCTC	3 cut(s)	10, 161, 176
Mox20I	TGGCCA	1 cut(s)	8
MscI	TGGCCA	1 cut(s)	8
MseI	TTAA	1 cut(s)	180
Msp20I	TGGCCA	1 cut(s)	8
MspA1I	CMGCKG	1 cut(s)	32
MspR9I	CCNGG	2 cut(s)	232, 374
Mva1269I	GAATGC	1 cut(s)	196
MvaI	CCWGG	2 cut(s)	232, 374
MwoI	GCNNNNNNNGC	1 cut(s)	333
NcoI	CCATGG	1 cut(s)	24
NdeII	GATC	1 cut(s)	313
NheI	GCTAGC	1 cut(s)	305
NlaIII	CATG	1 cut(s)	28
NmuCI	GTSAC	1 cut(s)	34
PctI	GAATGC	1 cut(s)	196
PkrI	GCNGC	4 cut(s)	31, 44, 110, 338
Psp124BI	GAGCTC	1 cut(s)	62
Psp6I	CCWGG	2 cut(s)	230, 372
PspGI	CCWGG	2 cut(s)	230, 372
PvuII	CAGCTG	1 cut(s)	32
RsaI	GTAC	1 cut(s)	149
RsaNI	GTAC	1 cut(s)	148
SacI	GAGCTC	1 cut(s)	62
SaqAI	TTAA	1 cut(s)	180
SatI	GCNGC	4 cut(s)	30, 43, 109, 337
Sau3AI	GATC	1 cut(s)	313
ScrFI	CCNGG	2 cut(s)	232, 374
SduI	GDGCHC	1 cut(s)	62
SmlI	CTYRAG	1 cut(s)	167
SmoI	CTYRAG	1 cut(s)	167
Sse9I	AATT	1 cut(s)	173
SspI	AATATT	1 cut(s)	332
SspMI	CTAG	2 cut(s)	207, 306
SstI	GAGCTC	1 cut(s)	62
StyD4I	CCNGG	2 cut(s)	230, 372
StyI	CCWWGG	1 cut(s)	24
TasI	AATT	1 cut(s)	173
Tru1I	TTAA	1 cut(s)	180
Tru9I	TTAA	1 cut(s)	180
TseFI	GTSAC	1 cut(s)	34
TseI	GCWGC	4 cut(s)	29, 42, 108, 336
Tsp45I	GTSAC	1 cut(s)	34
XagI	CCTNNNNNAGG	1 cut(s)	229
XapI	RAATTY	1 cut(s)	173
XcmI	CCANNNNNNNNNTGG	1 cut(s)	370
XspI	CTAG	2 cut(s)	207, 306

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.