Prupe.6G090800_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
6210879 .. 6211864
986 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G090800.1

Sequence Viewer

Length: 219 bp
ATGGCAACCGCTTCTCCAGCACCCAAAGAGAAGAAAAACCCAAGCTTTCCTCCAAGGAGGGGCCTCATCAAGCTTCAGATCTTTGAAAAATTGGTCAAAGTGGTGGTCAACAAGGCCTCCAACCCTGGAGCTCAGGGGAAAAACAGAGGAGAAGATAGTGGTGGAAGCTCTACCTCTCAAACCCCACCATCAAGTGCCTACAGCTCTGATGCAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

7.51

Weight (kDa)

10.09

Isoelectric Point (pI)

57.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 9
AcuI CTGAAG 1 cut(s) 59
AfiI CCNNNNNNNGG 1 cut(s) 59
AgsI TTSAA 1 cut(s) 86
AjnI CCWGG 1 cut(s) 124
AluBI AGCT 5 cut(s) 45, 73, 131, 168, 204
AluI AGCT 5 cut(s) 45, 73, 131, 168, 204
Alw21I GWGCWC 1 cut(s) 133
AoxI GGCC 2 cut(s) 61, 114
ArsI GACNNNNNNTTYG 2 cut(s) 90, 122
AspS9I GGNCC 1 cut(s) 61
BanII GRGCYC 1 cut(s) 133
Bbv12I GWGCWC 1 cut(s) 133
BccI CCATC 1 cut(s) 196
BciT130I CCWGG 1 cut(s) 126
BfmI CTRYAG 1 cut(s) 199
BglII AGATCT 1 cut(s) 78
Bme1390I CCNGG 1 cut(s) 126
BmgT120I GGNCC 1 cut(s) 61
BmiI GGNNCC 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 126
BmsI GCATC 1 cut(s) 199
BpmI CTGGAG 1 cut(s) 147
Bpu10I CCTNAGC 1 cut(s) 132
BsaJI CCNNGG 2 cut(s) 53, 124
BsaXI ACNNNNNCTCC 3 cut(s) 28, 101, 131
Bsc4I CCNNNNNNNGG 1 cut(s) 59
BseBI CCWGG 1 cut(s) 126
BseDI CCNNGG 2 cut(s) 53, 124
BseLI CCNNNNNNNGG 1 cut(s) 59
BseMII CTCAG 1 cut(s) 146
BseRI GAGGAG 1 cut(s) 162
BshFI GGCC 2 cut(s) 63, 116
BsiHKAI GWGCWC 1 cut(s) 133
BslI CCNNNNNNNGG 1 cut(s) 59
BsnI GGCC 2 cut(s) 63, 116
Bsp1286I GDGCHC 1 cut(s) 133
Bsp143I GATC 1 cut(s) 78
BspACI CCGC 1 cut(s) 9
BspANI GGCC 2 cut(s) 63, 116
BspCNI CTCAG 1 cut(s) 145
BspLI GGNNCC 1 cut(s) 62
BssECI CCNNGG 2 cut(s) 53, 124
BssMI GATC 1 cut(s) 78
BssT1I CCWWGG 1 cut(s) 53
Bst2UI CCWGG 1 cut(s) 126
BstDEI CTNAG 1 cut(s) 132
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BstMWI GCNNNNNNNGC 1 cut(s) 17
BstNI CCWGG 1 cut(s) 126
BstSCI CCNGG 1 cut(s) 124
BstSFI CTRYAG 1 cut(s) 199
BstX2I RGATCY 1 cut(s) 78
BstYI RGATCY 1 cut(s) 78
BsuRI GGCC 2 cut(s) 63, 116
Cfr13I GGNCC 1 cut(s) 61
CviJI RGCY 7 cut(s) 45, 63, 73, 116, 131, 168, 204
CviKI_1 RGCY 7 cut(s) 45, 63, 73, 116, 131, 168, 204
DdeI CTNAG 1 cut(s) 132
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
Ecl136II GAGCTC 1 cut(s) 131
Eco130I CCWWGG 1 cut(s) 53
Eco147I AGGCCT 1 cut(s) 116
Eco24I GRGCYC 1 cut(s) 133
Eco53kI GAGCTC 1 cut(s) 131
Eco57I CTGAAG 1 cut(s) 59
EcoICRI GAGCTC 1 cut(s) 131
EcoO109I RGGNCCY 1 cut(s) 61
EcoRII CCWGG 1 cut(s) 124
EcoT14I CCWWGG 1 cut(s) 53
EcoT38I GRGCYC 1 cut(s) 133
ErhI CCWWGG 1 cut(s) 53
FriOI GRGCYC 1 cut(s) 133
GsuI CTGGAG 1 cut(s) 147
HaeIII GGCC 2 cut(s) 63, 116
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HindIII AAGCTT 2 cut(s) 43, 71
Hpy166II GTNNAC 1 cut(s) 109
Hpy188I TCNGA 2 cut(s) 78, 208
Hpy8I GTNNAC 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 212
HpyF10VI GCNNNNNNNGC 1 cut(s) 17
HpyF3I CTNAG 1 cut(s) 132
Kzo9I GATC 1 cut(s) 78
LmnI GCTCC 1 cut(s) 128
LpnPI CCDG 4 cut(s) 30, 111, 119, 138
LweI GCATC 1 cut(s) 199
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MboII GAAGA 2 cut(s) 43, 164
MflI RGATCY 1 cut(s) 78
MhlI GDGCHC 1 cut(s) 133
MluCI AATT 2 cut(s) 89, 214
MmeI TCCRAC 1 cut(s) 144
MnlI CCTC 6 cut(s) 51, 60, 74, 127, 140, 184
MspR9I CCNGG 1 cut(s) 126
MvaI CCWGG 1 cut(s) 126
MwoI GCNNNNNNNGC 1 cut(s) 17
NdeII GATC 1 cut(s) 78
NlaIV GGNNCC 1 cut(s) 62
PceI AGGCCT 1 cut(s) 116
Psp124BI GAGCTC 1 cut(s) 133
Psp6I CCWGG 1 cut(s) 124
PspGI CCWGG 1 cut(s) 124
PspN4I GGNNCC 1 cut(s) 62
PspPI GGNCC 1 cut(s) 61
PsuI RGATCY 1 cut(s) 78
SacI GAGCTC 1 cut(s) 133
Sau3AI GATC 1 cut(s) 78
Sau96I GGNCC 1 cut(s) 61
ScrFI CCNGG 1 cut(s) 126
SduI GDGCHC 1 cut(s) 133
SetI ASST 6 cut(s) 47, 75, 133, 170, 176, 206
SfaNI GCATC 1 cut(s) 199
SfcI CTRYAG 1 cut(s) 199
SgeI CNNG 9 cut(s) 29, 54, 66, 82, 124, 137, 138, 146, 204
Sse9I AATT 2 cut(s) 89, 214
SseBI AGGCCT 1 cut(s) 116
SsiI CCGC 1 cut(s) 9
SstI GAGCTC 1 cut(s) 133
StuI AGGCCT 1 cut(s) 116
StyD4I CCNGG 1 cut(s) 124
StyI CCWWGG 1 cut(s) 53
TasI AATT 2 cut(s) 89, 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.