Rh1AG005100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
704828 .. 705037
210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG005100.1

Sequence Viewer

Length: 210 bp
ATGGAGGAACTCGTTGAAGGAGCTAATGAAGATGTGACGATGGACGATGCTGTTTGGCTAGTTGTTGGTGACGGCTTTCAATTACATCAGCTTGAAGGATACCCACACTGCAAATGCAAGTTGCATGATCGTCAATGTGTGAGGTACATTCTTCACATTAAGGGCTACACCAACAGGAATACAACTAATTGTACAATTTTAACTGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.94

Weight (kDa)

5.36

Isoelectric Point (pI)

20.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 146, 193
AgsI TTSAA 3 cut(s) 17, 80, 95
AluBI AGCT 2 cut(s) 23, 91
AluI AGCT 2 cut(s) 23, 91
AsuHPI GGTGA 1 cut(s) 80
BccI CCATC 1 cut(s) 34
BceAI ACGGC 1 cut(s) 88
BciVI GTATCC 1 cut(s) 92
BfaI CTAG 1 cut(s) 59
BfuI GTATCC 1 cut(s) 92
BmsI GCATC 1 cut(s) 37
Bsp1407I TGTACA 1 cut(s) 191
Bsp143I GATC 1 cut(s) 127
BsrGI TGTACA 1 cut(s) 191
BssMI GATC 1 cut(s) 127
Bst4CI ACNGT 1 cut(s) 205
BstAUI TGTACA 1 cut(s) 191
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BsuI GTATCC 1 cut(s) 92
BtsI GCAGTG 1 cut(s) 106
BtsIMutI CAGTG 1 cut(s) 106
Csp6I GTAC 2 cut(s) 145, 192
CviAII CATG 1 cut(s) 125
CviJI RGCY 5 cut(s) 23, 58, 75, 91, 165
CviKI_1 RGCY 5 cut(s) 23, 58, 75, 91, 165
CviQI GTAC 2 cut(s) 145, 192
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
FaeI CATG 1 cut(s) 128
FaiI YATR 2 cut(s) 126, 208
FatI CATG 1 cut(s) 124
FspBI CTAG 1 cut(s) 59
Hin1II CATG 1 cut(s) 128
HphI GGTGA 1 cut(s) 80
HpyAV CCTTC 2 cut(s) 11, 89
HpyCH4III ACNGT 1 cut(s) 205
HpyCH4V TGCA 3 cut(s) 111, 117, 124
Hsp92II CATG 1 cut(s) 128
Kzo9I GATC 1 cut(s) 127
LmnI GCTCC 1 cut(s) 20
LpnPI CCDG 1 cut(s) 160
LweI GCATC 1 cut(s) 37
MaeI CTAG 1 cut(s) 59
MaeIII GTNAC 2 cut(s) 34, 68
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 2 cut(s) 41, 143
MluCI AATT 3 cut(s) 80, 187, 195
MnlI CCTC 1 cut(s) 135
MseI TTAA 2 cut(s) 159, 200
NdeII GATC 1 cut(s) 127
NlaIII CATG 1 cut(s) 128
NmuCI GTSAC 2 cut(s) 34, 68
RsaI GTAC 2 cut(s) 146, 193
RsaNI GTAC 2 cut(s) 145, 192
SaqAI TTAA 2 cut(s) 159, 200
Sau3AI GATC 1 cut(s) 127
SetI ASST 3 cut(s) 25, 93, 146
SfaNI GCATC 1 cut(s) 37
SgeI CNNG 6 cut(s) 23, 71, 104, 130, 137, 187
Sse9I AATT 3 cut(s) 80, 187, 195
SspMI CTAG 1 cut(s) 59
TaaI ACNGT 1 cut(s) 205
TasI AATT 3 cut(s) 80, 187, 195
TatI WGTACW 1 cut(s) 191
Tru1I TTAA 2 cut(s) 159, 200
Tru9I TTAA 2 cut(s) 159, 200
TscAI CASTG 1 cut(s) 113
TseFI GTSAC 2 cut(s) 34, 68
Tsp45I GTSAC 2 cut(s) 34, 68
TspDTI ATGAA 1 cut(s) 42
TspRI CASTG 1 cut(s) 113
XspI CTAG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.