Rroxscaffold_1G00019100

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
23293978 .. 23294193
216 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00019100.1

Sequence Viewer

Length: 216 bp
ATGGCAACCGCTTCTCTAACACCTCAAAAGAAGAAAACCACTGGCCTTCCACCAACAAAGAGGGGCAAAATCAAGGCTCGGATTCTCGGAAACATGTTCAAAGCTGTGGTCTCCATGTTCAAGCGCAAAAAGATAGCCACTGAAGGTGGTGGAGGCTCTGCCTCTCCAACACCACCACTCAGTGGCTACAACTCCAATGGCTGCCCCAATGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.38

Weight (kDa)

10.91

Isoelectric Point (pI)

35.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 182
AciI CCGC 1 cut(s) 9
AcuI CTGAAG 1 cut(s) 162
AdeI CACNNNGTG 1 cut(s) 182
AfiI CCNNNNNNNGG 1 cut(s) 182
AflIII ACRYGT 1 cut(s) 93
AgsI TTSAA 2 cut(s) 100, 121
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
Alw26I GTCTC 1 cut(s) 115
AoxI GGCC 1 cut(s) 43
ApeKI GCWGC 1 cut(s) 201
ArsI GACNNNNNNTTYG 2 cut(s) 93, 125
AspLEI GCGC 1 cut(s) 126
BbvI GCAGC 1 cut(s) 188
BcoDI GTCTC 1 cut(s) 115
BisI GCNGC 1 cut(s) 202
BlsI GCNGC 1 cut(s) 203
BsaI GGTCTC 1 cut(s) 115
Bsc4I CCNNNNNNNGG 1 cut(s) 182
Bse1I ACTGG 1 cut(s) 46
BseLI CCNNNNNNNGG 1 cut(s) 182
BseMII CTCAG 1 cut(s) 193
BseNI ACTGG 1 cut(s) 46
BseXI GCAGC 1 cut(s) 188
BshFI GGCC 1 cut(s) 45
BslI CCNNNNNNNGG 1 cut(s) 182
BsmAI GTCTC 1 cut(s) 115
BsnI GGCC 1 cut(s) 45
Bso31I GGTCTC 1 cut(s) 115
BspACI CCGC 1 cut(s) 9
BspANI GGCC 1 cut(s) 45
BspCNI CTCAG 1 cut(s) 192
BspTNI GGTCTC 1 cut(s) 115
BsrI ACTGG 1 cut(s) 46
BstDEI CTNAG 1 cut(s) 179
BstHHI GCGC 1 cut(s) 126
BstMAI GTCTC 1 cut(s) 115
BstNSI RCATGY 1 cut(s) 97
BstV1I GCAGC 1 cut(s) 188
BsuRI GGCC 1 cut(s) 45
BtsIMutI CAGTG 3 cut(s) 39, 138, 187
CfoI GCGC 1 cut(s) 126
CviAII CATG 2 cut(s) 94, 115
CviJI RGCY 7 cut(s) 45, 77, 104, 137, 156, 186, 201
CviKI_1 RGCY 7 cut(s) 45, 77, 104, 137, 156, 186, 201
DdeI CTNAG 1 cut(s) 179
DraIII CACNNNGTG 1 cut(s) 182
Eco31I GGTCTC 1 cut(s) 115
Eco57I CTGAAG 1 cut(s) 162
FaeI CATG 2 cut(s) 97, 118
FaiI YATR 2 cut(s) 95, 116
FatI CATG 2 cut(s) 93, 114
Fnu4HI GCNGC 1 cut(s) 202
Fsp4HI GCNGC 1 cut(s) 202
GlaI GCGC 1 cut(s) 125
GluI GCNGC 1 cut(s) 202
HaeIII GGCC 1 cut(s) 45
HhaI GCGC 1 cut(s) 126
Hin1II CATG 2 cut(s) 97, 118
Hin6I GCGC 1 cut(s) 124
HinP1I GCGC 1 cut(s) 124
HinfI GANTC 1 cut(s) 82
Hpy188I TCNGA 2 cut(s) 81, 89
HpyAV CCTTC 2 cut(s) 56, 137
HpyF3I CTNAG 1 cut(s) 179
Hsp92II CATG 2 cut(s) 97, 118
HspAI GCGC 1 cut(s) 124
LpnPI CCDG 1 cut(s) 27
Lsp1109I GCAGC 1 cut(s) 188
MboII GAAGA 1 cut(s) 43
MmeI TCCRAC 1 cut(s) 191
MnlI CCTC 4 cut(s) 33, 54, 146, 172
NlaIII CATG 2 cut(s) 97, 118
NspI RCATGY 1 cut(s) 97
PciI ACATGT 1 cut(s) 93
PfeI GAWTC 1 cut(s) 82
PflMI CCANNNNNTGG 1 cut(s) 182
PkrI GCNGC 1 cut(s) 203
PscI ACATGT 1 cut(s) 93
SatI GCNGC 1 cut(s) 202
SetI ASST 3 cut(s) 25, 106, 148
SgeI CNNG 7 cut(s) 54, 85, 90, 98, 106, 127, 133
SsiI CCGC 1 cut(s) 9
TfiI GAWTC 1 cut(s) 82
TscAI CASTG 3 cut(s) 46, 145, 187
TseI GCWGC 1 cut(s) 201
TspRI CASTG 3 cut(s) 46, 145, 187
Van91I CCANNNNNTGG 1 cut(s) 182
XceI RCATGY 1 cut(s) 97
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.