RchiOBHm_Chr5g0061741

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
67356085 .. 67356663
579 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33808

Sequence Viewer

Length: 171 bp
ATGGAAAGCCCAAACTTGAAGATGATAGAGAACCCAGATTCAAAATTCATGCTTTTCCCAAATCGACCCATCCTTCCTCCCAAGAGGGGAGAGATCAGGAAGAAGATTTTCAACGACTTATTAAGTTCATTGTGTTCGATGACCCGCCGAAAGAAGATGGAGGGTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.55

Weight (kDa)

10.13

Isoelectric Point (pI)

75.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 145
AcsI RAATTY 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 86
AgsI TTSAA 3 cut(s) 19, 42, 112
ApoI RAATTY 1 cut(s) 44
Asp700I GAANNNNTTC 1 cut(s) 107
BccI CCATC 2 cut(s) 77, 151
Bsc4I CCNNNNNNNGG 1 cut(s) 86
BseGI GGATG 1 cut(s) 69
BseLI CCNNNNNNNGG 1 cut(s) 86
BslI CCNNNNNNNGG 1 cut(s) 86
Bsp143I GATC 1 cut(s) 93
BspACI CCGC 1 cut(s) 145
BssMI GATC 1 cut(s) 93
BstF5I GGATG 1 cut(s) 69
BstKTI GATC 1 cut(s) 96
BstMBI GATC 1 cut(s) 93
BtsCI GGATG 1 cut(s) 69
CviAII CATG 1 cut(s) 49
CviJI RGCY 1 cut(s) 9
CviKI_1 RGCY 1 cut(s) 9
DpnI GATC 1 cut(s) 95
DpnII GATC 1 cut(s) 93
FaeI CATG 1 cut(s) 52
FaiI YATR 1 cut(s) 50
FatI CATG 1 cut(s) 48
FauI CCCGC 1 cut(s) 152
FokI GGATG 1 cut(s) 56
Hin1II CATG 1 cut(s) 52
HinfI GANTC 1 cut(s) 38
Hpy188III TCNNGA 2 cut(s) 97, 168
HpyAV CCTTC 1 cut(s) 83
Hsp92II CATG 1 cut(s) 52
Kzo9I GATC 1 cut(s) 93
LpnPI CCDG 2 cut(s) 48, 82
MalI GATC 1 cut(s) 95
MboI GATC 1 cut(s) 93
MboII GAAGA 4 cut(s) 31, 112, 115, 166
MluCI AATT 1 cut(s) 44
MnlI CCTC 3 cut(s) 78, 87, 154
MroXI GAANNNNTTC 1 cut(s) 107
MseI TTAA 1 cut(s) 122
NdeII GATC 1 cut(s) 93
NlaIII CATG 1 cut(s) 52
PdmI GAANNNNTTC 1 cut(s) 107
PfeI GAWTC 1 cut(s) 38
SaqAI TTAA 1 cut(s) 122
Sau3AI GATC 1 cut(s) 93
SgeI CNNG 6 cut(s) 28, 47, 61, 94, 109, 156
Sse9I AATT 1 cut(s) 44
SsiI CCGC 1 cut(s) 145
TaqI TCGA 2 cut(s) 64, 137
TasI AATT 1 cut(s) 44
TfiI GAWTC 1 cut(s) 38
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
TspDTI ATGAA 2 cut(s) 37, 117
XapI RAATTY 1 cut(s) 44
XmnI GAANNNNTTC 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.