Rroxscaffold_1G00019040

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
23161521 .. 23161746
226 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00019040.1

Sequence Viewer

Length: 195 bp
ATGGAAAACCGAAACACCGTATCCAAATCTAACCCCAAGCAAAGCCTCTACCTTCCCAGGAGAGGGCAGGTGAAGATCAAGATATTCAAGGGCTTGTTCAAGTCGTTGGCTTCGATGTTGGTTGGGTTTGCCCGTAAGCCAGCAAGAGAAGATGGAGGAAAGCCCAAGTGGGTATTGCTGAGATGCTCAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.28

Weight (kDa)

11.12

Isoelectric Point (pI)

23.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 58
Acc36I ACCTGC 1 cut(s) 58
AfiI CCNNNNNNNGG 2 cut(s) 62, 63
AgsI TTSAA 2 cut(s) 88, 100
AjnI CCWGG 1 cut(s) 56
AsuHPI GGTGA 1 cut(s) 82
BccI CCATC 1 cut(s) 146
BciT130I CCWGG 1 cut(s) 58
BciVI GTATCC 1 cut(s) 31
BfuAI ACCTGC 1 cut(s) 58
BfuI GTATCC 1 cut(s) 31
Bme1390I CCNGG 1 cut(s) 58
BmrFI CCNGG 1 cut(s) 58
BmsI GCATC 1 cut(s) 173
BsaJI CCNNGG 1 cut(s) 56
Bsc4I CCNNNNNNNGG 2 cut(s) 62, 63
BseBI CCWGG 1 cut(s) 58
BseDI CCNNGG 1 cut(s) 56
BseLI CCNNNNNNNGG 2 cut(s) 62, 63
BseMII CTCAG 1 cut(s) 170
BslI CCNNNNNNNGG 2 cut(s) 62, 63
Bsp143I GATC 1 cut(s) 75
BspCNI CTCAG 1 cut(s) 171
BspMI ACCTGC 1 cut(s) 58
BssECI CCNNGG 1 cut(s) 56
BssMI GATC 1 cut(s) 75
Bst2UI CCWGG 1 cut(s) 58
Bst4CI ACNGT 1 cut(s) 19
BstC8I GCNNGC 1 cut(s) 141
BstDEI CTNAG 1 cut(s) 179
BstKTI GATC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
BstNI CCWGG 1 cut(s) 58
BstSCI CCNGG 1 cut(s) 56
BsuI GTATCC 1 cut(s) 31
BveI ACCTGC 1 cut(s) 58
Cac8I GCNNGC 1 cut(s) 141
CviJI RGCY 5 cut(s) 45, 93, 110, 139, 163
CviKI_1 RGCY 5 cut(s) 45, 93, 110, 139, 163
DdeI CTNAG 1 cut(s) 179
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
EcoRII CCWGG 1 cut(s) 56
HphI GGTGA 1 cut(s) 82
Hpy188I TCNGA 1 cut(s) 194
Hpy188III TCNNGA 1 cut(s) 79
HpyAV CCTTC 1 cut(s) 62
HpyCH4III ACNGT 1 cut(s) 19
HpyF3I CTNAG 1 cut(s) 179
Kzo9I GATC 1 cut(s) 75
LpnPI CCDG 4 cut(s) 43, 53, 70, 153
LweI GCATC 1 cut(s) 173
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MboII GAAGA 2 cut(s) 85, 161
MnlI CCTC 3 cut(s) 56, 56, 149
MspR9I CCNGG 1 cut(s) 58
MvaI CCWGG 1 cut(s) 58
NdeII GATC 1 cut(s) 75
PaqCI CACCTGC 1 cut(s) 58
PcsI WCGNNNNNNNCGW 1 cut(s) 110
Psp6I CCWGG 1 cut(s) 56
PspGI CCWGG 1 cut(s) 56
Sau3AI GATC 1 cut(s) 75
ScrFI CCNGG 1 cut(s) 58
SetI ASST 2 cut(s) 54, 72
SfaNI GCATC 1 cut(s) 173
StyD4I CCNGG 1 cut(s) 56
TaaI ACNGT 1 cut(s) 19
TaqI TCGA 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.