Prupe.7G240200_v2.0.a1
ERF Family

Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Reverse (-)
20699138 .. 20699622
485 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G240200.1

Sequence Viewer

Length: 225 bp
ATGATGAAAGAAAGCATGCTGCATTTGAAGTCCTTGAATCACATCTCATTGGTGTGCAGATCAGTTGAGAAATCCCTTGATTTCTACCAGAGTGTTCTTGGGTTCTTCCCAATTAGGAGTTCTGGCTCCTTTGACTTTAATGGTGCATGGCTATTCAATTATGGCATTGGCATACATCTTCTCCAATCTGAAGACCCTGATACCCAAGAAGATCACCCAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.48

Weight (kDa)

5.09

Isoelectric Point (pI)

55.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 210
AgsI TTSAA 3 cut(s) 28, 37, 157
AjuI GAANNNNNNNTTGG 2 cut(s) 103, 135
ApeKI GCWGC 1 cut(s) 19
AsuHPI GGTGA 1 cut(s) 206
BbsI GAAGAC 1 cut(s) 198
BbvI GCAGC 1 cut(s) 6
BisI GCNGC 1 cut(s) 20
BlsI GCNGC 1 cut(s) 21
BmiI GGNNCC 1 cut(s) 127
BpiI GAAGAC 1 cut(s) 198
BsaXI ACNNNNNCTCC 2 cut(s) 165, 195
BseXI GCAGC 1 cut(s) 6
BsgI GTGCAG 1 cut(s) 76
Bsp143I GATC 2 cut(s) 59, 211
BspLI GGNNCC 1 cut(s) 127
BssMI GATC 2 cut(s) 59, 211
BstC8I GCNNGC 1 cut(s) 17
BstKTI GATC 2 cut(s) 62, 214
BstMBI GATC 2 cut(s) 59, 211
BstNSI RCATGY 1 cut(s) 19
BstV1I GCAGC 1 cut(s) 6
BstV2I GAAGAC 1 cut(s) 198
Cac8I GCNNGC 1 cut(s) 17
CviAII CATG 2 cut(s) 16, 147
CviJI RGCY 2 cut(s) 126, 151
CviKI_1 RGCY 2 cut(s) 126, 151
DpnI GATC 2 cut(s) 61, 213
DpnII GATC 2 cut(s) 59, 211
Eco57I CTGAAG 1 cut(s) 210
FaeI CATG 2 cut(s) 19, 150
FaiI YATR 4 cut(s) 17, 148, 162, 173
FatI CATG 2 cut(s) 15, 146
Fnu4HI GCNGC 1 cut(s) 20
Fsp4HI GCNGC 1 cut(s) 20
GluI GCNGC 1 cut(s) 20
Hin1II CATG 2 cut(s) 19, 150
HinfI GANTC 1 cut(s) 37
HphI GGTGA 1 cut(s) 206
Hpy188I TCNGA 1 cut(s) 190
HpyCH4V TGCA 3 cut(s) 22, 57, 146
Hsp92II CATG 2 cut(s) 19, 150
Kzo9I GATC 2 cut(s) 59, 211
LmnI GCTCC 1 cut(s) 131
LpnPI CCDG 3 cut(s) 101, 108, 210
Lsp1109I GCAGC 1 cut(s) 6
MalI GATC 2 cut(s) 61, 213
MboI GATC 2 cut(s) 59, 211
MboII GAAGA 4 cut(s) 97, 170, 203, 221
MluCI AATT 2 cut(s) 111, 157
MseI TTAA 2 cut(s) 138, 223
MslI CAYNNNNRTG 1 cut(s) 52
NdeII GATC 2 cut(s) 59, 211
NlaIII CATG 2 cut(s) 19, 150
NlaIV GGNNCC 1 cut(s) 127
NspI RCATGY 1 cut(s) 19
PaeI GCATGC 1 cut(s) 19
PfeI GAWTC 1 cut(s) 37
PkrI GCNGC 1 cut(s) 21
PspN4I GGNNCC 1 cut(s) 127
RseI CAYNNNNRTG 1 cut(s) 52
SaqAI TTAA 2 cut(s) 138, 223
SatI GCNGC 1 cut(s) 20
Sau3AI GATC 2 cut(s) 59, 211
SgeI CNNG 9 cut(s) 28, 46, 89, 100, 110, 135, 159, 209, 218
SmiMI CAYNNNNRTG 1 cut(s) 52
SphI GCATGC 1 cut(s) 19
Sse9I AATT 2 cut(s) 111, 157
TasI AATT 2 cut(s) 111, 157
TfiI GAWTC 1 cut(s) 37
Tru1I TTAA 2 cut(s) 138, 223
Tru9I TTAA 2 cut(s) 138, 223
TseI GCWGC 1 cut(s) 19
TspDTI ATGAA 1 cut(s) 20
XceI RCATGY 1 cut(s) 19
XcmI CCANNNNNNNNNTGG 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.