pycom01g12230

transcription factor

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
13035886 .. 13036068
183 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g12230.1

Sequence Viewer

Length: 183 bp
ATGTCGGGTCGAATGCTGAAAAAAGTTTTGAAGGACCAAGAAGAAGACAACCGACACGTAATGGAATCCGAATCAGAAGGAGAAGAAGAAAGCCAGCAGCTCAATGGAAAAGCTAAAATCAATCCCTTTGACCTCCTCAACGACGACGGTGAGGACGACGACCACCAGGTTCACTTTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.99

Weight (kDa)

4.43

Isoelectric Point (pI)

58.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 55
AgsI TTSAA 1 cut(s) 31
AjnI CCWGG 1 cut(s) 165
AluBI AGCT 2 cut(s) 100, 113
AluI AGCT 2 cut(s) 100, 113
ApeKI GCWGC 1 cut(s) 97
AspS9I GGNCC 1 cut(s) 34
AsuHPI GGTGA 1 cut(s) 161
AvaII GGWCC 1 cut(s) 34
BbsI GAAGAC 1 cut(s) 51
BbvI GCAGC 1 cut(s) 109
BciT130I CCWGG 1 cut(s) 167
BisI GCNGC 1 cut(s) 98
BlsI GCNGC 1 cut(s) 99
Bme1390I CCNGG 1 cut(s) 167
Bme18I GGWCC 1 cut(s) 34
BmgT120I GGNCC 1 cut(s) 34
BmrFI CCNGG 1 cut(s) 167
BpiI GAAGAC 1 cut(s) 51
BsaAI YACGTR 1 cut(s) 58
BseBI CCWGG 1 cut(s) 167
BseRI GAGGAG 1 cut(s) 125
BseXI GCAGC 1 cut(s) 109
BsmI GAATGC 1 cut(s) 18
Bst2UI CCWGG 1 cut(s) 167
Bst4CI ACNGT 1 cut(s) 149
BstBAI YACGTR 1 cut(s) 58
BstC8I GCNNGC 1 cut(s) 95
BstNI CCWGG 1 cut(s) 167
BstSCI CCNGG 1 cut(s) 165
BstV1I GCAGC 1 cut(s) 109
BstV2I GAAGAC 1 cut(s) 51
Cac8I GCNNGC 1 cut(s) 95
Cfr13I GGNCC 1 cut(s) 34
CsiI ACCWGGT 1 cut(s) 165
CviJI RGCY 3 cut(s) 93, 100, 113
CviKI_1 RGCY 3 cut(s) 93, 100, 113
Eco47I GGWCC 1 cut(s) 34
EcoRII CCWGG 1 cut(s) 165
Fnu4HI GCNGC 1 cut(s) 98
Fsp4HI GCNGC 1 cut(s) 98
GluI GCNGC 1 cut(s) 98
HinfI GANTC 2 cut(s) 65, 71
HphI GGTGA 1 cut(s) 161
Hpy166II GTNNAC 1 cut(s) 172
Hpy188I TCNGA 2 cut(s) 70, 76
Hpy8I GTNNAC 1 cut(s) 172
Hpy99I CGWCG 3 cut(s) 146, 149, 161
HpyAV CCTTC 2 cut(s) 25, 71
HpyCH4III ACNGT 1 cut(s) 149
HpyCH4IV ACGT 1 cut(s) 57
HpySE526I ACGT 1 cut(s) 57
LpnPI CCDG 3 cut(s) 107, 152, 179
Lsp1109I GCAGC 1 cut(s) 109
MabI ACCWGGT 1 cut(s) 165
MaeII ACGT 1 cut(s) 57
MboII GAAGA 4 cut(s) 53, 56, 95, 98
MnlI CCTC 3 cut(s) 143, 145, 146
MseI TTAA 1 cut(s) 181
MspR9I CCNGG 1 cut(s) 167
Mva1269I GAATGC 1 cut(s) 18
MvaI CCWGG 1 cut(s) 167
PcsI WCGNNNNNNNCGW 1 cut(s) 153
PctI GAATGC 1 cut(s) 18
PfeI GAWTC 2 cut(s) 65, 71
PkrI GCNGC 1 cut(s) 99
Ppu21I YACGTR 1 cut(s) 58
Psp6I CCWGG 1 cut(s) 165
PspGI CCWGG 1 cut(s) 165
PspPI GGNCC 1 cut(s) 34
SaqAI TTAA 1 cut(s) 181
SatI GCNGC 1 cut(s) 98
Sau96I GGNCC 1 cut(s) 34
ScrFI CCNGG 1 cut(s) 167
SetI ASST 5 cut(s) 60, 102, 115, 135, 171
SexAI ACCWGGT 1 cut(s) 165
SgeI CNNG 6 cut(s) 18, 50, 68, 106, 178, 179
SinI GGWCC 1 cut(s) 34
StyD4I CCNGG 1 cut(s) 165
TaaI ACNGT 1 cut(s) 149
TaiI ACGT 1 cut(s) 60
TaqI TCGA 1 cut(s) 10
TfiI GAWTC 2 cut(s) 65, 71
Tru1I TTAA 1 cut(s) 181
Tru9I TTAA 1 cut(s) 181
TseI GCWGC 1 cut(s) 97
VpaK11BI GGWCC 1 cut(s) 34
XcmI CCANNNNNNNNNTGG 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.