Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000124.1

Orthogroup ID

OG0007094

Physical Location & Seq

Genomic Coordinates Reverse (-)

96973 .. 97671

Gene Structure 699 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000124.1_g000023.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 276 bp

atgtctgctcggtatctgaagaaagtgttgaaggaagaacaagaggagcgacaattggaatcagaccacgaagaagaagaagaagacgacgaccaccgccagctcaacggcaaagcaaagatcaaccctttcgacctcctcaacgacgacgacaacgacgccgacgacccccagcagtacagagcaatccactatccaacttctggactatcaccctttaaagcctgggagtttacaggttgcaaaattctgctgtctcttgtttcaattggttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Tcf25

Protein Analysis

91

Amino Acids

10.57

Weight (kDa)

4.51

Isoelectric Point (pI)

58.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007094)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G46900
fragaria_vesca	FvH4_7g18270 FvH4_7g18270
malus_domestica	MD01G1098500.v1.1 MD02G1051800.v1.1 MD07G1165200.v1.1
prunus_persica	Prupe.2G203900_v2.0.a1 Prupe.2G203900_v2.0.a1
pyrus_communis	pycom01g11990 pycom01g12090 pycom01g12230 pycom01g12240 pycom01g12540 pycom07g16040
rosa_chinensis	RchiOBHm_Chr1g0361851
rosa_laevigata	RLG00000027697
rosa_multiflora	Rmu_ssc0000124.1_g000015 Rmu_ssc0000124.1_g000023
rosa_roxburghii	Rroxscaffold_4G00294650
rosa_rugosa	Rorug01G0291900
rosa_samantha	Rh1AG302500 Rh1BG265600 Rh1CG283700 Rh1DG295600
rosa_wichuraiana	Rw1G026800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	203
AciI	CCGC	1 cut(s)	97
AcsI	RAATTY	1 cut(s)	246
AcuI	CTGAAG	1 cut(s)	38
AcyI	GRCGYC	1 cut(s)	159
AfaI	GTAC	1 cut(s)	179
AfiI	CCNNNNNNNGG	1 cut(s)	203
AgsI	TTSAA	2 cut(s)	31, 267
AjnI	CCWGG	1 cut(s)	224
AluBI	AGCT	1 cut(s)	103
AluI	AGCT	1 cut(s)	103
Alw26I	GTCTC	1 cut(s)	261
ApoI	RAATTY	1 cut(s)	246
AsuHPI	GGTGA	1 cut(s)	204
BbsI	GAAGAC	1 cut(s)	90
BceAI	ACGGC	1 cut(s)	124
BciT130I	CCWGG	1 cut(s)	226
BcoDI	GTCTC	1 cut(s)	261
Bme1390I	CCNGG	1 cut(s)	226
BmrFI	CCNGG	1 cut(s)	226
BpiI	GAAGAC	1 cut(s)	90
BsaHI	GRCGYC	1 cut(s)	159
BsaJI	CCNNGG	1 cut(s)	225
Bsc4I	CCNNNNNNNGG	1 cut(s)	203
BseBI	CCWGG	1 cut(s)	226
BseDI	CCNNGG	1 cut(s)	225
BseLI	CCNNNNNNNGG	1 cut(s)	203
BseRI	GAGGAG	2 cut(s)	59, 128
BseYI	CCCAGC	1 cut(s)	171
BslI	CCNNNNNNNGG	1 cut(s)	203
BsmAI	GTCTC	1 cut(s)	261
Bsp143I	GATC	1 cut(s)	120
BspACI	CCGC	1 cut(s)	97
BssECI	CCNNGG	1 cut(s)	225
BssMI	GATC	1 cut(s)	120
BssNI	GRCGYC	1 cut(s)	159
Bst2UI	CCWGG	1 cut(s)	226
BstACI	GRCGYC	1 cut(s)	159
BstC8I	GCNNGC	1 cut(s)	101
BstKTI	GATC	1 cut(s)	123
BstMAI	GTCTC	1 cut(s)	261
BstMBI	GATC	1 cut(s)	120
BstNI	CCWGG	1 cut(s)	226
BstSCI	CCNGG	1 cut(s)	224
BstV2I	GAAGAC	1 cut(s)	90
Cac8I	GCNNGC	1 cut(s)	101
CseI	GACGC	1 cut(s)	167
Csp6I	GTAC	1 cut(s)	178
CviJI	RGCY	2 cut(s)	103, 224
CviKI_1	RGCY	2 cut(s)	103, 224
CviQI	GTAC	1 cut(s)	178
DpnI	GATC	1 cut(s)	122
DpnII	GATC	1 cut(s)	120
DraI	TTTAAA	1 cut(s)	220
Eco57I	CTGAAG	1 cut(s)	38
EcoRII	CCWGG	1 cut(s)	224
GsaI	CCCAGC	1 cut(s)	175
HgaI	GACGC	1 cut(s)	167
Hin1I	GRCGYC	1 cut(s)	159
HinfI	GANTC	1 cut(s)	59
HphI	GGTGA	1 cut(s)	204
Hpy166II	GTNNAC	1 cut(s)	234
Hpy188I	TCNGA	2 cut(s)	18, 64
Hpy188III	TCNNGA	1 cut(s)	204
Hpy8I	GTNNAC	1 cut(s)	234
Hpy99I	CGWCG	5 cut(s)	92, 149, 152, 161, 167
HpyAV	CCTTC	1 cut(s)	25
HpyCH4V	TGCA	1 cut(s)	243
Hsp92I	GRCGYC	1 cut(s)	159
Kzo9I	GATC	1 cut(s)	120
LmnI	GCTCC	1 cut(s)	46
LpnPI	CCDG	6 cut(s)	113, 185, 189, 211, 222, 238
MalI	GATC	1 cut(s)	122
MboI	GATC	1 cut(s)	120
MboII	GAAGA	7 cut(s)	31, 47, 83, 86, 89, 92, 95
MfeI	CAATTG	2 cut(s)	53, 267
MluCI	AATT	3 cut(s)	53, 246, 267
MmeI	TCCRAC	1 cut(s)	221
MnlI	CCTC	3 cut(s)	37, 146, 149
MseI	TTAA	2 cut(s)	219, 274
MspR9I	CCNGG	1 cut(s)	226
MunI	CAATTG	2 cut(s)	53, 267
MvaI	CCWGG	1 cut(s)	226
NdeII	GATC	1 cut(s)	120
PcsI	WCGNNNNNNNCGW	2 cut(s)	153, 162
PfeI	GAWTC	1 cut(s)	59
PflMI	CCANNNNNTGG	1 cut(s)	203
Psp6I	CCWGG	1 cut(s)	224
PspFI	CCCAGC	1 cut(s)	171
PspGI	CCWGG	1 cut(s)	224
RsaI	GTAC	1 cut(s)	179
RsaNI	GTAC	1 cut(s)	178
SaqAI	TTAA	2 cut(s)	219, 274
Sau3AI	GATC	1 cut(s)	120
ScrFI	CCNGG	1 cut(s)	226
SetI	ASST	3 cut(s)	105, 138, 241
Sse9I	AATT	3 cut(s)	53, 246, 267
SsiI	CCGC	1 cut(s)	97
StyD4I	CCNGG	1 cut(s)	224
TaqI	TCGA	1 cut(s)	132
TasI	AATT	3 cut(s)	53, 246, 267
TatI	WGTACW	1 cut(s)	177
TfiI	GAWTC	1 cut(s)	59
Tru1I	TTAA	2 cut(s)	219, 274
Tru9I	TTAA	2 cut(s)	219, 274
Van91I	CCANNNNNTGG	1 cut(s)	203
XapI	RAATTY	1 cut(s)	246

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.