pycom01g14940

helix loop helix domain

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Reverse (-)
14981137 .. 14982502
1366 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g14940.3

Sequence Viewer

Length: 447 bp
ATGACAAATTGGGATGCACAAATGGACATGAACAGCAAAATTGAGTTTTGCATGGGATCCAACGCATCCGAAAGTGACAACCATGATAACATGAGAGCTGCAGACTATTCTCTTCCTCTGCAGCAGTCATCATCCCTCATTACCTATCAACCTGCAGTTAATTATCCATCTGGTTCGTTGAGATATGATGTCATTTCAGAGCAGTCATCGTTCCTGGACAAAAAGATTTCAGCCCCCCAATTTCAAGCAGATTGCCACGCCATGCAAAATGCAAGGAAACGTCCAATTGAGGTTGATGACTTTGGTGGTCTTGTTGGTGACAGAACATCTCTCAACGAATTATACAAACATAAGAGAAGCAAGATGACAAATAATAATTCTCAACAACAATGGCATCAACAGCTCCAAGAAAACTCAATGGAGCAACAAAACAATAAGGTATCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

149

Amino Acids

16.93

Weight (kDa)

5.48

Isoelectric Point (pI)

66.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 160
AclWI GGATC 2 cut(s) 51, 64
AgsI TTSAA 1 cut(s) 245
AjnI CCWGG 1 cut(s) 213
AluBI AGCT 2 cut(s) 98, 403
AluI AGCT 2 cut(s) 98, 403
AlwI GGATC 2 cut(s) 51, 64
ApeKI GCWGC 2 cut(s) 98, 121
AsuHPI GGTGA 1 cut(s) 329
BamHI GGATCC 1 cut(s) 56
BbvI GCAGC 2 cut(s) 85, 133
BccI CCATC 1 cut(s) 175
BciT130I CCWGG 1 cut(s) 215
BfmI CTRYAG 3 cut(s) 99, 119, 153
BfuAI ACCTGC 1 cut(s) 160
BisI GCNGC 2 cut(s) 99, 122
BlsI GCNGC 2 cut(s) 100, 123
Bme1390I CCNGG 1 cut(s) 215
BmiI GGNNCC 1 cut(s) 58
BmrFI CCNGG 1 cut(s) 215
BmsI GCATC 3 cut(s) 4, 74, 403
BseBI CCWGG 1 cut(s) 215
BseGI GGATG 3 cut(s) 19, 65, 131
BseXI GCAGC 2 cut(s) 85, 133
Bsp143I GATC 1 cut(s) 56
BspLI GGNNCC 1 cut(s) 58
BspMAI CTGCAG 3 cut(s) 103, 123, 157
BspMI ACCTGC 1 cut(s) 160
BspPI GGATC 2 cut(s) 51, 64
BssMI GATC 1 cut(s) 56
Bst2UI CCWGG 1 cut(s) 215
Bst6I CTCTTC 1 cut(s) 117
BstF5I GGATG 3 cut(s) 19, 65, 131
BstKTI GATC 1 cut(s) 59
BstMBI GATC 1 cut(s) 56
BstMWI GCNNNNNNNGC 1 cut(s) 400
BstNI CCWGG 1 cut(s) 215
BstSCI CCNGG 1 cut(s) 213
BstSFI CTRYAG 3 cut(s) 99, 119, 153
BstV1I GCAGC 2 cut(s) 85, 133
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
BtsCI GGATG 3 cut(s) 19, 65, 131
BveI ACCTGC 1 cut(s) 160
CviAII CATG 5 cut(s) 28, 52, 83, 91, 262
CviJI RGCY 3 cut(s) 98, 233, 403
CviKI_1 RGCY 3 cut(s) 98, 233, 403
DpnI GATC 1 cut(s) 58
DpnII GATC 1 cut(s) 56
Eam1104I CTCTTC 1 cut(s) 117
EarI CTCTTC 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 213
FaeI CATG 5 cut(s) 31, 55, 86, 94, 265
FaiI YATR 8 cut(s) 29, 53, 84, 92, 186, 263, 343, 351
FatI CATG 5 cut(s) 27, 51, 82, 90, 261
Fnu4HI GCNGC 2 cut(s) 99, 122
FokI GGATG 3 cut(s) 26, 52, 118
Fsp4HI GCNGC 2 cut(s) 99, 122
GluI GCNGC 2 cut(s) 99, 122
Hin1II CATG 5 cut(s) 31, 55, 86, 94, 265
HphI GGTGA 1 cut(s) 329
Hpy188I TCNGA 2 cut(s) 70, 199
HpyCH4IV ACGT 1 cut(s) 280
HpyCH4V TGCA 7 cut(s) 17, 51, 101, 121, 155, 265, 272
HpyF10VI GCNNNNNNNGC 1 cut(s) 400
HpySE526I ACGT 1 cut(s) 280
Hsp92II CATG 5 cut(s) 31, 55, 86, 94, 265
Kzo9I GATC 1 cut(s) 56
LmnI GCTCC 2 cut(s) 408, 421
LpnPI CCDG 4 cut(s) 156, 165, 200, 227
Lsp1109I GCAGC 2 cut(s) 85, 133
LweI GCATC 3 cut(s) 4, 74, 403
MaeII ACGT 1 cut(s) 280
MaeIII GTNAC 2 cut(s) 74, 317
MalI GATC 1 cut(s) 58
MboI GATC 1 cut(s) 56
MboII GAAGA 1 cut(s) 104
MfeI CAATTG 1 cut(s) 285
MflI RGATCY 1 cut(s) 56
MluCI AATT 7 cut(s) 7, 39, 160, 239, 285, 338, 376
MmeI TCCRAC 1 cut(s) 84
MnlI CCTC 3 cut(s) 126, 146, 283
MseI TTAA 1 cut(s) 159
MspR9I CCNGG 1 cut(s) 215
MunI CAATTG 1 cut(s) 285
MvaI CCWGG 1 cut(s) 215
MwoI GCNNNNNNNGC 1 cut(s) 400
NdeII GATC 1 cut(s) 56
NlaIII CATG 5 cut(s) 31, 55, 86, 94, 265
NlaIV GGNNCC 1 cut(s) 58
NmuCI GTSAC 2 cut(s) 74, 317
PfoI TCCNGGA 1 cut(s) 213
PkrI GCNGC 2 cut(s) 100, 123
Psp6I CCWGG 1 cut(s) 213
PspGI CCWGG 1 cut(s) 213
PspN4I GGNNCC 1 cut(s) 58
PstI CTGCAG 3 cut(s) 103, 123, 157
PsuI RGATCY 1 cut(s) 56
SaqAI TTAA 1 cut(s) 159
SatI GCNGC 2 cut(s) 99, 122
Sau3AI GATC 1 cut(s) 56
ScrFI CCNGG 1 cut(s) 215
SetI ASST 7 cut(s) 100, 146, 154, 283, 294, 405, 441
SfaNI GCATC 3 cut(s) 4, 74, 403
SfcI CTRYAG 3 cut(s) 99, 119, 153
Sse9I AATT 7 cut(s) 7, 39, 160, 239, 285, 338, 376
StyD4I CCNGG 1 cut(s) 213
TaiI ACGT 1 cut(s) 283
TasI AATT 7 cut(s) 7, 39, 160, 239, 285, 338, 376
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TseFI GTSAC 2 cut(s) 74, 317
TseI GCWGC 2 cut(s) 98, 121
Tsp45I GTSAC 2 cut(s) 74, 317
TspDTI ATGAA 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.