pycom03g14940

protein localization to endoplasmic reticulum exit site

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0006254
Physical Location & Seq
Reverse (-)
16330541 .. 16331704
1164 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g14940.2

Sequence Viewer

Length: 378 bp
ATGGGGTTAGATCGATCGAAGCAAGGACGGGGGCCATTGGTGGCGAAGAGCGTGGGAGGAACCGTTCTCGTCTTTTTTAGCTCCACCATATATAGTGTATTCAGTGTTCAAAAAAGTTTATCAGAGGCAGGCTTTGTCAATCCGACAGATGAGGTTCTTATGGCACATCGTCTCCTGGAAGCATCTCTCATAGGGTTTTCCCTATTCCTGGCAATGATTATAGATAGACTACACTACTATATCAAAGAGCTCCATCTGCTACGAGGACTCGTCGAAGAAGTGAAGAATCTGAAAAAGGATTATGAGCACAGGAAATCTACTGCTCCTGCAGAAGTGAAGAAGGCAACACAAATGATCGATTACGCATCTAAAAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04141 ko05165 map04141 map05165
Pfam Domains
Protein Families
No domains found.

Protein Analysis

126

Amino Acids

13.96

Weight (kDa)

9.36

Isoelectric Point (pI)

25.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 208
AgsI TTSAA 1 cut(s) 110
AjnI CCWGG 2 cut(s) 174, 207
AloI GAACNNNNNNTCC 2 cut(s) 48, 80
AluBI AGCT 3 cut(s) 81, 250, 375
AluI AGCT 3 cut(s) 81, 250, 375
Alw21I GWGCWC 2 cut(s) 252, 309
Alw26I GTCTC 1 cut(s) 176
AoxI GGCC 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 32
BanII GRGCYC 1 cut(s) 252
Bbv12I GWGCWC 2 cut(s) 252, 309
BccI CCATC 1 cut(s) 261
BciT130I CCWGG 2 cut(s) 176, 209
BcoDI GTCTC 1 cut(s) 176
BfmI CTRYAG 1 cut(s) 327
Bme1390I CCNGG 2 cut(s) 176, 209
BmgT120I GGNCC 1 cut(s) 32
BmiI GGNNCC 2 cut(s) 33, 61
BmrFI CCNGG 2 cut(s) 176, 209
BmsI GCATC 2 cut(s) 191, 374
Bsa29I ATCGAT 2 cut(s) 13, 357
BsaXI ACNNNNNCTCC 4 cut(s) 48, 78, 156, 186
Bsc4I CCNNNNNNNGG 1 cut(s) 208
Bse3DI GCAATG 1 cut(s) 219
BseBI CCWGG 2 cut(s) 176, 209
BseCI ATCGAT 2 cut(s) 13, 357
BseLI CCNNNNNNNGG 1 cut(s) 208
BseMI GCAATG 1 cut(s) 219
Bsh1285I CGRYCG 1 cut(s) 17
BshFI GGCC 1 cut(s) 34
BshVI ATCGAT 2 cut(s) 13, 357
BsiEI CGRYCG 1 cut(s) 17
BsiHKAI GWGCWC 2 cut(s) 252, 309
BslI CCNNNNNNNGG 1 cut(s) 208
BsmAI GTCTC 1 cut(s) 176
BsmBI CGTCTC 1 cut(s) 176
BsnI GGCC 1 cut(s) 34
Bsp1286I GDGCHC 2 cut(s) 252, 309
Bsp143I GATC 3 cut(s) 10, 14, 354
BspANI GGCC 1 cut(s) 34
BspDI ATCGAT 2 cut(s) 13, 357
BspLI GGNNCC 2 cut(s) 33, 61
BspMAI CTGCAG 1 cut(s) 331
BspQI GCTCTTC 1 cut(s) 41
BsrDI GCAATG 1 cut(s) 219
BssMI GATC 3 cut(s) 10, 14, 354
Bst2UI CCWGG 2 cut(s) 176, 209
Bst4CI ACNGT 1 cut(s) 64
Bst6I CTCTTC 1 cut(s) 41
BstC8I GCNNGC 1 cut(s) 130
BstKTI GATC 3 cut(s) 13, 17, 357
BstMAI GTCTC 1 cut(s) 176
BstMBI GATC 3 cut(s) 10, 14, 354
BstMCI CGRYCG 1 cut(s) 17
BstMWI GCNNNNNNNGC 1 cut(s) 256
BstNI CCWGG 2 cut(s) 176, 209
BstSCI CCNGG 2 cut(s) 174, 207
BstSFI CTRYAG 1 cut(s) 327
Bsu15I ATCGAT 2 cut(s) 13, 357
BsuRI GGCC 1 cut(s) 34
BsuTUI ATCGAT 2 cut(s) 13, 357
BtsIMutI CAGTG 1 cut(s) 109
Cac8I GCNNGC 1 cut(s) 130
Cfr13I GGNCC 1 cut(s) 32
ClaI ATCGAT 2 cut(s) 13, 357
CviJI RGCY 5 cut(s) 34, 81, 132, 250, 375
CviKI_1 RGCY 5 cut(s) 34, 81, 132, 250, 375
DpnI GATC 3 cut(s) 12, 16, 356
DpnII GATC 3 cut(s) 10, 14, 354
Eam1104I CTCTTC 1 cut(s) 41
EarI CTCTTC 1 cut(s) 41
Ecl136II GAGCTC 1 cut(s) 250
Eco24I GRGCYC 1 cut(s) 252
Eco53kI GAGCTC 1 cut(s) 250
EcoICRI GAGCTC 1 cut(s) 250
EcoRII CCWGG 2 cut(s) 174, 207
EcoT38I GRGCYC 1 cut(s) 252
Esp3I CGTCTC 1 cut(s) 176
FaiI YATR 8 cut(s) 89, 91, 93, 161, 191, 221, 240, 303
FriOI GRGCYC 1 cut(s) 252
HaeIII GGCC 1 cut(s) 34
HinfI GANTC 2 cut(s) 267, 286
Hpy188I TCNGA 3 cut(s) 124, 144, 291
Hpy99I CGWCG 1 cut(s) 275
HpyAV CCTTC 1 cut(s) 334
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 1 cut(s) 329
HpyF10VI GCNNNNNNNGC 1 cut(s) 256
Kzo9I GATC 3 cut(s) 10, 14, 354
LguI GCTCTTC 1 cut(s) 41
LmnI GCTCC 3 cut(s) 86, 255, 328
LpnPI CCDG 7 cut(s) 114, 161, 188, 194, 221, 295, 339
LweI GCATC 2 cut(s) 191, 374
MalI GATC 3 cut(s) 12, 16, 356
MboI GATC 3 cut(s) 10, 14, 354
MboII GAAGA 4 cut(s) 58, 287, 295, 349
MhlI GDGCHC 2 cut(s) 252, 309
MlyI GAGTC 1 cut(s) 261
MmeI TCCRAC 1 cut(s) 167
MnlI CCTC 4 cut(s) 50, 118, 145, 257
MspR9I CCNGG 2 cut(s) 176, 209
MvaI CCWGG 2 cut(s) 176, 209
MwoI GCNNNNNNNGC 1 cut(s) 256
NdeII GATC 3 cut(s) 10, 14, 354
NlaIV GGNNCC 2 cut(s) 33, 61
PciSI GCTCTTC 1 cut(s) 41
PfeI GAWTC 1 cut(s) 286
PfoI TCCNGGA 1 cut(s) 174
Ple19I CGATCG 1 cut(s) 17
PleI GAGTC 1 cut(s) 261
PpsI GAGTC 1 cut(s) 261
Psp124BI GAGCTC 1 cut(s) 252
Psp6I CCWGG 2 cut(s) 174, 207
PspGI CCWGG 2 cut(s) 174, 207
PspN4I GGNNCC 2 cut(s) 33, 61
PspPI GGNCC 1 cut(s) 32
PsrI GAACNNNNNNTAC 2 cut(s) 90, 122
PstI CTGCAG 1 cut(s) 331
PvuI CGATCG 1 cut(s) 17
SacI GAGCTC 1 cut(s) 252
SapI GCTCTTC 1 cut(s) 41
Sau3AI GATC 3 cut(s) 10, 14, 354
Sau96I GGNCC 1 cut(s) 32
SchI GAGTC 1 cut(s) 261
ScrFI CCNGG 2 cut(s) 176, 209
SduI GDGCHC 2 cut(s) 252, 309
SetI ASST 4 cut(s) 83, 156, 252, 377
SfaNI GCATC 2 cut(s) 191, 374
SfcI CTRYAG 1 cut(s) 327
SstI GAGCTC 1 cut(s) 252
StyD4I CCNGG 2 cut(s) 174, 207
TaaI ACNGT 1 cut(s) 64
TaqI TCGA 4 cut(s) 13, 17, 273, 357
TfiI GAWTC 1 cut(s) 286
TscAI CASTG 1 cut(s) 109
TspRI CASTG 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.