Rroxscaffold_1G00039960

protein localization to endoplasmic reticulum exit site

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
57611769 .. 57613596
1828 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00039960.1

Sequence Viewer

Length: 168 bp
ATGGCATACCGTCTATTAGAAGCATCTCTTATAGGGTTTTCCATATTCTTGGCACTGATGATAGATAGGCTGCATTACTATATCAAGGTGCTCTATCGACTTAGAAATTACAGGGAAGAAGAAGTGAAAAGGAATGCAATGAGCATAGCAAGATCAGGAAAAGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.55

Weight (kDa)

9.99

Isoelectric Point (pI)

48.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Alw21I GWGCWC 1 cut(s) 93
ApeKI GCWGC 1 cut(s) 70
Bbv12I GWGCWC 1 cut(s) 93
BbvI GCAGC 1 cut(s) 57
BisI GCNGC 1 cut(s) 71
BlsI GCNGC 1 cut(s) 72
BmsI GCATC 1 cut(s) 32
Bse3DI GCAATG 1 cut(s) 144
BseMI GCAATG 1 cut(s) 144
BseXI GCAGC 1 cut(s) 57
BsiHKAI GWGCWC 1 cut(s) 93
BsmI GAATGC 1 cut(s) 139
Bsp1286I GDGCHC 1 cut(s) 93
Bsp143I GATC 1 cut(s) 152
BsrDI GCAATG 1 cut(s) 144
BssMI GATC 1 cut(s) 152
Bst4CI ACNGT 1 cut(s) 11
BstDEI CTNAG 1 cut(s) 101
BstKTI GATC 1 cut(s) 155
BstMBI GATC 1 cut(s) 152
BstV1I GCAGC 1 cut(s) 57
BstXI CCANNNNNNTGG 1 cut(s) 49
BtsIMutI CAGTG 1 cut(s) 53
CviJI RGCY 1 cut(s) 70
CviKI_1 RGCY 1 cut(s) 70
DdeI CTNAG 1 cut(s) 101
DpnI GATC 1 cut(s) 154
DpnII GATC 1 cut(s) 152
FaiI YATR 6 cut(s) 7, 32, 44, 81, 146, 166
FalI AAGNNNNNCTT 2 cut(s) 12, 44
Fnu4HI GCNGC 1 cut(s) 71
Fsp4HI GCNGC 1 cut(s) 71
GluI GCNGC 1 cut(s) 71
Hpy188III TCNNGA 1 cut(s) 156
HpyCH4III ACNGT 1 cut(s) 11
HpyCH4V TGCA 2 cut(s) 73, 137
HpyF3I CTNAG 1 cut(s) 101
Kzo9I GATC 1 cut(s) 152
LpnPI CCDG 2 cut(s) 97, 141
Lsp1109I GCAGC 1 cut(s) 57
LweI GCATC 1 cut(s) 32
MalI GATC 1 cut(s) 154
MboI GATC 1 cut(s) 152
MboII GAAGA 2 cut(s) 128, 131
MhlI GDGCHC 1 cut(s) 93
MluCI AATT 1 cut(s) 106
Mva1269I GAATGC 1 cut(s) 139
NdeII GATC 1 cut(s) 152
PctI GAATGC 1 cut(s) 139
PkrI GCNGC 1 cut(s) 72
SatI GCNGC 1 cut(s) 71
Sau3AI GATC 1 cut(s) 152
SduI GDGCHC 1 cut(s) 93
SetI ASST 1 cut(s) 90
SfaNI GCATC 1 cut(s) 32
SgeI CNNG 4 cut(s) 61, 97, 124, 162
Sse9I AATT 1 cut(s) 106
TaaI ACNGT 1 cut(s) 11
TaqI TCGA 1 cut(s) 97
TasI AATT 1 cut(s) 106
TscAI CASTG 1 cut(s) 60
TseI GCWGC 1 cut(s) 70
TspRI CASTG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.