pycom03g17270

General transcription factor 3C polypeptide

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
Physical Location & Seq
Reverse (-)
18457014 .. 18459947
2934 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g17270.2

Sequence Viewer

Length: 423 bp
ATGGAGTCAAAAGAAGAAGAAGAATATGTATTGCTCGATCTCGATTCCGTTTCCTCGCAGTTTGAAATTCCACCAAACGCACCCTATTCTTTTTCCGGTCTAAACACGGAGCATCCAGTATTGACTATAGGCGACAAACTCAAGTTGATAGGAGAATATCAAGAAACGATTGGAACATGCCTTATATTCAAAGAAGAAGATGCTAGCCCTGCGGTTCATGAAGAAATGGGACCATCAGAAGCAAACCTTTTTGCAGGCAAATGCATAATGGATCCAGATCAATCTCCAAGCAAGCAAGTAAAACCAGTTACGAGCCTTCAAAGGATTTTAAAATTTAGACTGGCACCCAATCTCGATTCTCATGATCCACCTGAACAGTCTCGGGATCCGGTGCTACATACAGTGCAATCAGTGGCCGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

141

Amino Acids

15.54

Weight (kDa)

4.53

Isoelectric Point (pI)

64.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 343
AciI CCGC 1 cut(s) 212
AclWI GGATC 5 cut(s) 266, 279, 359, 380, 393
AcoI YGGCCR 1 cut(s) 414
AcsI RAATTY 2 cut(s) 66, 332
AgsI TTSAA 3 cut(s) 65, 190, 320
Alw26I GTCTC 1 cut(s) 384
AlwI GGATC 5 cut(s) 266, 279, 359, 380, 393
Ama87I CYCGRG 1 cut(s) 381
AoxI GGCC 1 cut(s) 414
ApoI RAATTY 2 cut(s) 66, 332
AspS9I GGNCC 1 cut(s) 230
AsuNHI GCTAGC 1 cut(s) 203
AvaI CYCGRG 1 cut(s) 381
AvaII GGWCC 1 cut(s) 230
BamHI GGATCC 2 cut(s) 271, 385
BanI GGYRCC 1 cut(s) 343
BccI CCATC 1 cut(s) 241
BcoDI GTCTC 1 cut(s) 384
BfaI CTAG 1 cut(s) 204
BfmI CTRYAG 1 cut(s) 126
Bme18I GGWCC 1 cut(s) 230
BmeT110I CYCGRG 1 cut(s) 381
BmgT120I GGNCC 1 cut(s) 230
BmiI GGNNCC 4 cut(s) 231, 273, 345, 387
BmsI GCATC 2 cut(s) 121, 190
BmtI GCTAGC 1 cut(s) 207
BpuEI CTTGAG 1 cut(s) 125
BsaBI GATNNNNATC 1 cut(s) 276
BsaWI WCCGGW 2 cut(s) 95, 388
Bse1I ACTGG 3 cut(s) 116, 305, 345
Bse8I GATNNNNATC 1 cut(s) 276
BseGI GGATG 1 cut(s) 112
BseJI GATNNNNATC 1 cut(s) 276
BseNI ACTGG 3 cut(s) 116, 305, 345
BshFI GGCC 1 cut(s) 416
BshNI GGYRCC 1 cut(s) 343
BsiHKCI CYCGRG 1 cut(s) 381
BsiSI CCGG 2 cut(s) 96, 389
BslFI GGGAC 1 cut(s) 243
BsmAI GTCTC 1 cut(s) 384
BsmFI GGGAC 1 cut(s) 243
BsnI GGCC 1 cut(s) 416
BsoBI CYCGRG 1 cut(s) 381
Bsp143I GATC 5 cut(s) 37, 271, 277, 364, 385
BspACI CCGC 1 cut(s) 212
BspANI GGCC 1 cut(s) 416
BspHI TCATGA 2 cut(s) 217, 361
BspLI GGNNCC 4 cut(s) 231, 273, 345, 387
BspOI GCTAGC 1 cut(s) 207
BspPI GGATC 5 cut(s) 266, 279, 359, 380, 393
BspT107I GGYRCC 1 cut(s) 343
BsrI ACTGG 3 cut(s) 116, 305, 345
BssMI GATC 5 cut(s) 37, 271, 277, 364, 385
Bst4CI ACNGT 2 cut(s) 378, 403
BstC8I GCNNGC 3 cut(s) 205, 256, 293
BstF5I GGATG 1 cut(s) 112
BstKTI GATC 5 cut(s) 40, 274, 280, 367, 388
BstMAI GTCTC 1 cut(s) 384
BstMBI GATC 5 cut(s) 37, 271, 277, 364, 385
BstMWI GCNNNNNNNGC 1 cut(s) 209
BstNSI RCATGY 1 cut(s) 180
BstSFI CTRYAG 1 cut(s) 126
BstX2I RGATCY 2 cut(s) 271, 385
BstYI RGATCY 2 cut(s) 271, 385
BsuRI GGCC 1 cut(s) 416
BtsCI GGATG 1 cut(s) 112
BtsIMutI CAGTG 2 cut(s) 408, 417
Cac8I GCNNGC 3 cut(s) 205, 256, 293
CciI TCATGA 2 cut(s) 217, 361
Cfr13I GGNCC 1 cut(s) 230
CviAII CATG 3 cut(s) 177, 218, 362
CviJI RGCY 3 cut(s) 207, 315, 416
CviKI_1 RGCY 3 cut(s) 207, 315, 416
DpnI GATC 5 cut(s) 39, 273, 279, 366, 387
DpnII GATC 5 cut(s) 37, 271, 277, 364, 385
DraI TTTAAA 1 cut(s) 330
EaeI YGGCCR 1 cut(s) 414
Eco47I GGWCC 1 cut(s) 230
Eco88I CYCGRG 1 cut(s) 381
EcoT22I ATGCAT 1 cut(s) 266
FaeI CATG 3 cut(s) 180, 221, 365
FaiI YATR 8 cut(s) 27, 128, 178, 185, 219, 266, 363, 399
FalI AAGNNNNNCTT 2 cut(s) 231, 263
FaqI GGGAC 1 cut(s) 243
FatI CATG 3 cut(s) 176, 217, 361
FokI GGATG 1 cut(s) 99
FspBI CTAG 1 cut(s) 204
HaeIII GGCC 1 cut(s) 416
HapII CCGG 2 cut(s) 96, 389
Hin1II CATG 3 cut(s) 180, 221, 365
HinfI GANTC 3 cut(s) 5, 44, 356
HpaII CCGG 2 cut(s) 96, 389
Hpy188I TCNGA 1 cut(s) 238
Hpy188III TCNNGA 7 cut(s) 41, 161, 218, 275, 353, 362, 383
HpyAV CCTTC 1 cut(s) 326
HpyCH4III ACNGT 2 cut(s) 378, 403
HpyCH4V TGCA 3 cut(s) 254, 264, 406
HpyF10VI GCNNNNNNNGC 1 cut(s) 209
Hsp92II CATG 3 cut(s) 180, 221, 365
Kzo9I GATC 5 cut(s) 37, 271, 277, 364, 385
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 9 cut(s) 109, 129, 222, 240, 288, 318, 326, 384, 402
LweI GCATC 2 cut(s) 121, 190
MaeI CTAG 1 cut(s) 204
MaeIII GTNAC 1 cut(s) 307
MalI GATC 5 cut(s) 39, 273, 279, 366, 387
MboI GATC 5 cut(s) 37, 271, 277, 364, 385
MboII GAAGA 6 cut(s) 26, 29, 32, 206, 209, 233
MflI RGATCY 2 cut(s) 271, 385
MluCI AATT 2 cut(s) 66, 332
MlyI GAGTC 1 cut(s) 14
MnlI CCTC 1 cut(s) 64
Mph1103I ATGCAT 1 cut(s) 266
MseI TTAA 1 cut(s) 329
MspI CCGG 2 cut(s) 96, 389
MwoI GCNNNNNNNGC 1 cut(s) 209
NdeII GATC 5 cut(s) 37, 271, 277, 364, 385
NheI GCTAGC 1 cut(s) 203
NlaIII CATG 3 cut(s) 180, 221, 365
NlaIV GGNNCC 4 cut(s) 231, 273, 345, 387
NsiI ATGCAT 1 cut(s) 266
NspI RCATGY 1 cut(s) 180
PagI TCATGA 2 cut(s) 217, 361
PfeI GAWTC 2 cut(s) 44, 356
PleI GAGTC 1 cut(s) 13
PpsI GAGTC 1 cut(s) 13
PspN4I GGNNCC 4 cut(s) 231, 273, 345, 387
PspPI GGNCC 1 cut(s) 230
PsuI RGATCY 2 cut(s) 271, 385
SaqAI TTAA 1 cut(s) 329
Sau3AI GATC 5 cut(s) 37, 271, 277, 364, 385
Sau96I GGNCC 1 cut(s) 230
SchI GAGTC 1 cut(s) 14
SetI ASST 2 cut(s) 249, 373
SfaNI GCATC 2 cut(s) 121, 190
SfcI CTRYAG 1 cut(s) 126
SinI GGWCC 1 cut(s) 230
SmlI CTYRAG 1 cut(s) 140
SmoI CTYRAG 1 cut(s) 140
Sse9I AATT 2 cut(s) 66, 332
SsiI CCGC 1 cut(s) 212
SspMI CTAG 1 cut(s) 204
TaaI ACNGT 2 cut(s) 378, 403
TaqI TCGA 3 cut(s) 36, 42, 354
TasI AATT 2 cut(s) 66, 332
TfiI GAWTC 2 cut(s) 44, 356
Tru1I TTAA 1 cut(s) 329
Tru9I TTAA 1 cut(s) 329
TscAI CASTG 2 cut(s) 408, 417
TspDTI ATGAA 2 cut(s) 206, 234
TspGWI ACGGA 2 cut(s) 37, 122
TspRI CASTG 2 cut(s) 408, 417
VpaK11BI GGWCC 1 cut(s) 230
XapI RAATTY 2 cut(s) 66, 332
XceI RCATGY 1 cut(s) 180
XspI CTAG 1 cut(s) 204
Zsp2I ATGCAT 1 cut(s) 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.