pycom05g04540

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0004437
Physical Location & Seq
Forward (+)
5338120 .. 5339469
1350 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g04540.1

Sequence Viewer

Length: 654 bp
ATGCCTAGGAATGAGTTCTGGGGTTTCAACAAATTGAGAAACATTCTTGAACTACTTCGTCGCAATAGATCTTCGATTGGCAATGCATCGCCTGGACCGTTCCCAGCTACAGCAGTTTCTAAGGTTGACCAGGGTTATTCGATACAGCAAGGCTTACGGTATTTAAGTGTCAACAGCAAACCATGGACAAAACTCGATACAAAAATGGTAAACAGTGGAAAGGAAAAGGCTCAACAATTACAACCAGCAGCAACTCCTACTAGGCTCGGCATCGGTCAAAGGGTAAAATGGATTTTGGGATCCATATTGGCACTAATCCTTCCTTTTTGGATTCAGAATTGGGGAAAACTCAAAAGGATTGAAGGAGAGGCAGAAATGGTTGTGGAAGAGGTAGAGAAAGTAGTCGAGGTTGTAGAAAGGGTGGCAACTGTGGCGGAGAAGGTGTCCGAGGACGTTGCCGACGAACTCCCTGATAATACCAAACTAAAGGAAAAGGTTTTACTGGCAGAACATGTTTTCAAAGTGGCTGCTAAAGATGCTAAACTAGCTGAAGATTTCATTCACAAGGTGGAAACGTTGAAGCATGATCTGGAAGACTTGGAGACAATAGCAGAATCCATTGTTGATAATAATAACCATAAGATTGGGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

218

Amino Acids

24.42

Weight (kDa)

7.87

Isoelectric Point (pI)

37.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 434
AclI AACGTT 1 cut(s) 575
AclWI GGATC 2 cut(s) 294, 307
AcuI CTGAAG 1 cut(s) 570
AdeI CACNNNGTG 1 cut(s) 568
AflIII ACRYGT 1 cut(s) 511
AgsI TTSAA 5 cut(s) 28, 50, 362, 520, 580
AjnI CCWGG 2 cut(s) 91, 129
AluBI AGCT 2 cut(s) 107, 548
AluI AGCT 2 cut(s) 107, 548
Alw26I GTCTC 1 cut(s) 596
AlwI GGATC 2 cut(s) 294, 307
ApeKI GCWGC 2 cut(s) 248, 527
Asp700I GAANNNNTTC 2 cut(s) 14, 54
AspA2I CCTAGG 1 cut(s) 5
AspS9I GGNCC 1 cut(s) 95
AvaII GGWCC 1 cut(s) 95
AvrII CCTAGG 1 cut(s) 5
BamHI GGATCC 1 cut(s) 299
BbsI GAAGAC 1 cut(s) 600
BbvI GCAGC 2 cut(s) 260, 514
BcgI CGANNNNNNTGC 2 cut(s) 437, 471
BciT130I CCWGG 2 cut(s) 93, 131
BcoDI GTCTC 1 cut(s) 596
BfaI CTAG 3 cut(s) 6, 261, 545
BfmI CTRYAG 1 cut(s) 108
BglII AGATCT 1 cut(s) 68
BisI GCNGC 2 cut(s) 249, 528
BlnI CCTAGG 1 cut(s) 5
BlsI GCNGC 2 cut(s) 250, 529
Bme1390I CCNGG 2 cut(s) 93, 131
Bme18I GGWCC 1 cut(s) 95
BmgT120I GGNCC 1 cut(s) 95
BmiI GGNNCC 1 cut(s) 301
BmrFI CCNGG 2 cut(s) 93, 131
BmsI GCATC 3 cut(s) 95, 279, 526
BpiI GAAGAC 1 cut(s) 600
BsaJI CCNNGG 4 cut(s) 5, 130, 182, 447
BsaXI ACNNNNNCTCC 2 cut(s) 428, 458
Bse1I ACTGG 1 cut(s) 507
Bse3DI GCAATG 1 cut(s) 88
BseBI CCWGG 2 cut(s) 93, 131
BseDI CCNNGG 4 cut(s) 5, 130, 182, 447
BseMI GCAATG 1 cut(s) 88
BseNI ACTGG 1 cut(s) 507
BseXI GCAGC 2 cut(s) 260, 514
BseYI CCCAGC 1 cut(s) 103
BsmAI GTCTC 1 cut(s) 596
Bsp143I GATC 3 cut(s) 68, 299, 586
Bsp19I CCATGG 1 cut(s) 182
BspACI CCGC 1 cut(s) 434
BspLI GGNNCC 1 cut(s) 301
BspPI GGATC 2 cut(s) 294, 307
BsrDI GCAATG 1 cut(s) 88
BsrI ACTGG 1 cut(s) 507
BssECI CCNNGG 4 cut(s) 5, 130, 182, 447
BssMI GATC 3 cut(s) 68, 299, 586
BssT1I CCWWGG 2 cut(s) 5, 182
Bst2UI CCWGG 2 cut(s) 93, 131
Bst4CI ACNGT 4 cut(s) 99, 159, 215, 430
Bst6I CTCTTC 1 cut(s) 381
BstDEI CTNAG 1 cut(s) 120
BstDSI CCRYGG 1 cut(s) 182
BstKTI GATC 3 cut(s) 71, 302, 589
BstMAI GTCTC 1 cut(s) 596
BstMBI GATC 3 cut(s) 68, 299, 586
BstMWI GCNNNNNNNGC 3 cut(s) 431, 536, 545
BstNI CCWGG 2 cut(s) 93, 131
BstNSI RCATGY 1 cut(s) 515
BstSCI CCNGG 2 cut(s) 91, 129
BstSFI CTRYAG 1 cut(s) 108
BstV1I GCAGC 2 cut(s) 260, 514
BstV2I GAAGAC 1 cut(s) 600
BstX2I RGATCY 2 cut(s) 68, 299
BstXI CCANNNNNNTGG 1 cut(s) 644
BstYI RGATCY 2 cut(s) 68, 299
BtgI CCRYGG 1 cut(s) 182
BtgZI GCGATG 1 cut(s) 72
BtsIMutI CAGTG 1 cut(s) 220
Cfr13I GGNCC 1 cut(s) 95
CviAII CATG 3 cut(s) 183, 512, 584
CviJI RGCY 6 cut(s) 107, 153, 230, 265, 527, 548
CviKI_1 RGCY 6 cut(s) 107, 153, 230, 265, 527, 548
DdeI CTNAG 1 cut(s) 120
DpnI GATC 3 cut(s) 70, 301, 588
DpnII GATC 3 cut(s) 68, 299, 586
DraIII CACNNNGTG 1 cut(s) 568
Eam1104I CTCTTC 1 cut(s) 381
EarI CTCTTC 1 cut(s) 381
EciI GGCGGA 1 cut(s) 449
Eco130I CCWWGG 2 cut(s) 5, 182
Eco47I GGWCC 1 cut(s) 95
Eco57I CTGAAG 1 cut(s) 570
EcoRII CCWGG 2 cut(s) 91, 129
EcoT14I CCWWGG 2 cut(s) 5, 182
EcoT22I ATGCAT 1 cut(s) 88
ErhI CCWWGG 2 cut(s) 5, 182
FaeI CATG 3 cut(s) 186, 515, 587
FaiI YATR 5 cut(s) 184, 305, 513, 585, 639
FatI CATG 3 cut(s) 182, 511, 583
Fnu4HI GCNGC 2 cut(s) 249, 528
Fsp4HI GCNGC 2 cut(s) 249, 528
FspBI CTAG 3 cut(s) 6, 261, 545
GluI GCNGC 2 cut(s) 249, 528
GsaI CCCAGC 1 cut(s) 107
Hin1II CATG 3 cut(s) 186, 515, 587
HincII GTYRAC 2 cut(s) 127, 172
HindII GTYRAC 2 cut(s) 127, 172
HinfI GANTC 2 cut(s) 331, 614
Hpy166II GTNNAC 3 cut(s) 127, 172, 211
Hpy188I TCNGA 2 cut(s) 336, 448
Hpy188III TCNNGA 2 cut(s) 47, 590
Hpy8I GTNNAC 3 cut(s) 127, 172, 211
Hpy99I CGWCG 2 cut(s) 63, 464
HpyAV CCTTC 3 cut(s) 329, 356, 433
HpyCH4III ACNGT 4 cut(s) 99, 159, 215, 430
HpyCH4IV ACGT 2 cut(s) 453, 575
HpyCH4V TGCA 1 cut(s) 86
HpyF10VI GCNNNNNNNGC 3 cut(s) 431, 536, 545
HpyF3I CTNAG 1 cut(s) 120
HpySE526I ACGT 2 cut(s) 453, 575
Hsp92II CATG 3 cut(s) 186, 515, 587
Kzo9I GATC 3 cut(s) 68, 299, 586
Lsp1109I GCAGC 2 cut(s) 260, 514
LweI GCATC 3 cut(s) 95, 279, 526
MaeI CTAG 3 cut(s) 6, 261, 545
MaeII ACGT 2 cut(s) 453, 575
MalI GATC 3 cut(s) 70, 301, 588
MboI GATC 3 cut(s) 68, 299, 586
MboII GAAGA 4 cut(s) 63, 398, 563, 605
MflI RGATCY 2 cut(s) 68, 299
MluCI AATT 3 cut(s) 32, 236, 337
MnlI CCTC 4 cut(s) 361, 382, 400, 442
Mph1103I ATGCAT 1 cut(s) 88
MroXI GAANNNNTTC 2 cut(s) 14, 54
MseI TTAA 1 cut(s) 164
MspR9I CCNGG 2 cut(s) 93, 131
MvaI CCWGG 2 cut(s) 93, 131
MwoI GCNNNNNNNGC 3 cut(s) 431, 536, 545
NcoI CCATGG 1 cut(s) 182
NdeII GATC 3 cut(s) 68, 299, 586
NlaIII CATG 3 cut(s) 186, 515, 587
NlaIV GGNNCC 1 cut(s) 301
NmeAIII GCCGAG 1 cut(s) 246
NsiI ATGCAT 1 cut(s) 88
NspI RCATGY 1 cut(s) 515
PciI ACATGT 1 cut(s) 511
PcsI WCGNNNNNNNCGW 2 cut(s) 95, 459
PdmI GAANNNNTTC 2 cut(s) 14, 54
PfeI GAWTC 2 cut(s) 331, 614
PkrI GCNGC 2 cut(s) 250, 529
PscI ACATGT 1 cut(s) 511
Psp1406I AACGTT 1 cut(s) 575
Psp6I CCWGG 2 cut(s) 91, 129
PspFI CCCAGC 1 cut(s) 103
PspGI CCWGG 2 cut(s) 91, 129
PspN4I GGNNCC 1 cut(s) 301
PspPI GGNCC 1 cut(s) 95
PsuI RGATCY 2 cut(s) 68, 299
SaqAI TTAA 1 cut(s) 164
SatI GCNGC 2 cut(s) 249, 528
Sau3AI GATC 3 cut(s) 68, 299, 586
Sau96I GGNCC 1 cut(s) 95
ScrFI CCNGG 2 cut(s) 93, 131
SfaNI GCATC 3 cut(s) 95, 279, 526
SfcI CTRYAG 1 cut(s) 108
SinI GGWCC 1 cut(s) 95
Sse9I AATT 3 cut(s) 32, 236, 337
SsiI CCGC 1 cut(s) 434
SspMI CTAG 3 cut(s) 6, 261, 545
StyD4I CCNGG 2 cut(s) 91, 129
StyI CCWWGG 2 cut(s) 5, 182
TaaI ACNGT 4 cut(s) 99, 159, 215, 430
TaiI ACGT 2 cut(s) 456, 578
TaqI TCGA 4 cut(s) 74, 140, 195, 405
TaqII GACCGA 1 cut(s) 263
TasI AATT 3 cut(s) 32, 236, 337
TfiI GAWTC 2 cut(s) 331, 614
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TscAI CASTG 1 cut(s) 220
TseI GCWGC 2 cut(s) 248, 527
TspDTI ATGAA 1 cut(s) 547
TspRI CASTG 1 cut(s) 220
VpaK11BI GGWCC 1 cut(s) 95
XceI RCATGY 1 cut(s) 515
XmaJI CCTAGG 1 cut(s) 5
XmnI GAANNNNTTC 2 cut(s) 14, 54
XspI CTAG 3 cut(s) 6, 261, 545
Zsp2I ATGCAT 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.