pycom09g05430

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Reverse (-)
4038727 .. 4039336
610 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g05430.2

Sequence Viewer

Length: 375 bp
ATGAAGCAAAAGGTGGTGATCAAGTTGTCTGTGCATGATGGAAGGGCCAAGGCCAAAGCTATGAAGACTGCAGTTGGGGTCGATGGCGTAAACTCAGCAAGTTATCAGCAAGATAAGAACCAAATGGAGGTAATGGGGGAAGGGATTGATGTGGTTCTGCTCACAACTTCGCTTAGAAAAAGAAAAAGCTTGAAGCATGCTGAGGTGGTGAGTGTGAGCCTTGTGGAGGAAAAAAAGAAAGAGGAAAAGAAAGAGGAAAAGAAAGAGGAGAAGAAGAGCGAGCCTGCACAGCTACAGTATGTCATGGGTTGCCCTCAATATGTGGTGACTTATCCTTCGTATGAAGAACCCCCCAATATATGCACCATTCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

13.94

Weight (kDa)

8.97

Isoelectric Point (pI)

46.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 127, 226
AgsI TTSAA 1 cut(s) 193
AluBI AGCT 3 cut(s) 59, 189, 292
AluI AGCT 3 cut(s) 59, 189, 292
AoxI GGCC 2 cut(s) 45, 51
ArsI GACNNNNNNTTYG 2 cut(s) 319, 351
AspS9I GGNCC 1 cut(s) 45
AsuHPI GGTGA 3 cut(s) 28, 220, 337
BbsI GAAGAC 1 cut(s) 71
BbvCI CCTCAGC 1 cut(s) 201
BccI CCATC 2 cut(s) 32, 77
BclI TGATCA 1 cut(s) 18
BfmI CTRYAG 2 cut(s) 69, 293
BmgT120I GGNCC 1 cut(s) 45
BpiI GAAGAC 1 cut(s) 71
Bpu10I CCTNAGC 1 cut(s) 201
BsaJI CCNNGG 1 cut(s) 48
Bsc4I CCNNNNNNNGG 2 cut(s) 127, 226
BseDI CCNNGG 1 cut(s) 48
BseLI CCNNNNNNNGG 2 cut(s) 127, 226
BseMII CTCAG 2 cut(s) 108, 192
BseRI GAGGAG 1 cut(s) 281
BsgI GTGCAG 1 cut(s) 270
BshFI GGCC 2 cut(s) 47, 53
BslI CCNNNNNNNGG 2 cut(s) 127, 226
BsnI GGCC 2 cut(s) 47, 53
Bsp143I GATC 1 cut(s) 18
BspANI GGCC 2 cut(s) 47, 53
BspCNI CTCAG 2 cut(s) 107, 193
BspMAI CTGCAG 1 cut(s) 73
BspQI GCTCTTC 1 cut(s) 269
BssECI CCNNGG 1 cut(s) 48
BssMI GATC 1 cut(s) 18
BssT1I CCWWGG 1 cut(s) 48
Bst4CI ACNGT 1 cut(s) 297
Bst6I CTCTTC 1 cut(s) 269
BstC8I GCNNGC 3 cut(s) 198, 281, 285
BstDEI CTNAG 3 cut(s) 94, 173, 201
BstENI CCTNNNNNAGG 1 cut(s) 224
BstKTI GATC 1 cut(s) 21
BstMBI GATC 1 cut(s) 18
BstMWI GCNNNNNNNGC 1 cut(s) 289
BstNSI RCATGY 1 cut(s) 200
BstSFI CTRYAG 2 cut(s) 69, 293
BstV2I GAAGAC 1 cut(s) 71
BsuRI GGCC 2 cut(s) 47, 53
Cac8I GCNNGC 3 cut(s) 198, 281, 285
Cfr13I GGNCC 1 cut(s) 45
CviAII CATG 3 cut(s) 35, 197, 304
CviJI RGCY 7 cut(s) 47, 53, 59, 189, 219, 283, 292
CviKI_1 RGCY 7 cut(s) 47, 53, 59, 189, 219, 283, 292
DdeI CTNAG 3 cut(s) 94, 173, 201
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
Eam1104I CTCTTC 1 cut(s) 269
EarI CTCTTC 1 cut(s) 269
Eco130I CCWWGG 1 cut(s) 48
EcoNI CCTNNNNNAGG 1 cut(s) 224
EcoT14I CCWWGG 1 cut(s) 48
ErhI CCWWGG 1 cut(s) 48
FaeI CATG 3 cut(s) 38, 200, 307
FaiI YATR 9 cut(s) 36, 62, 198, 300, 305, 321, 342, 359, 361
FatI CATG 3 cut(s) 34, 196, 303
FbaI TGATCA 1 cut(s) 18
HaeIII GGCC 2 cut(s) 47, 53
Hin1II CATG 3 cut(s) 38, 200, 307
HindIII AAGCTT 1 cut(s) 187
HphI GGTGA 3 cut(s) 28, 220, 337
Hpy166II GTNNAC 1 cut(s) 91
Hpy8I GTNNAC 1 cut(s) 91
HpyAV CCTTC 3 cut(s) 36, 134, 345
HpyCH4III ACNGT 1 cut(s) 297
HpyCH4V TGCA 4 cut(s) 34, 71, 287, 363
HpyF10VI GCNNNNNNNGC 1 cut(s) 289
HpyF3I CTNAG 3 cut(s) 94, 173, 201
Hsp92II CATG 3 cut(s) 38, 200, 307
Ksp22I TGATCA 1 cut(s) 18
Kzo9I GATC 1 cut(s) 18
LguI GCTCTTC 1 cut(s) 269
LpnPI CCDG 1 cut(s) 297
MaeIII GTNAC 1 cut(s) 325
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
MboII GAAGA 4 cut(s) 76, 283, 286, 356
MnlI CCTC 7 cut(s) 121, 196, 220, 235, 247, 259, 324
MwoI GCNNNNNNNGC 1 cut(s) 289
NdeII GATC 1 cut(s) 18
NlaIII CATG 3 cut(s) 38, 200, 307
NmuCI GTSAC 1 cut(s) 325
NspI RCATGY 1 cut(s) 200
PaeI GCATGC 1 cut(s) 200
PciSI GCTCTTC 1 cut(s) 269
PspPI GGNCC 1 cut(s) 45
PstI CTGCAG 1 cut(s) 73
SapI GCTCTTC 1 cut(s) 269
Sau3AI GATC 1 cut(s) 18
Sau96I GGNCC 1 cut(s) 45
SetI ASST 6 cut(s) 15, 61, 132, 191, 207, 294
SfcI CTRYAG 2 cut(s) 69, 293
SphI GCATGC 1 cut(s) 200
StyI CCWWGG 1 cut(s) 48
TaaI ACNGT 1 cut(s) 297
TaqI TCGA 1 cut(s) 81
TseFI GTSAC 1 cut(s) 325
Tsp45I GTSAC 1 cut(s) 325
TspDTI ATGAA 3 cut(s) 17, 77, 357
XagI CCTNNNNNAGG 1 cut(s) 224
XceI RCATGY 1 cut(s) 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.