pycom17g11110

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
8646519 .. 8647070
552 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g11110.1

Sequence Viewer

Length: 321 bp
ATGAAGCAAAAGGTCGTGATCAAGTTGTCTGTGCACGATGAAAGGACCAAAGCCAAAGCTATGAAAACTGCAGTTGGGGTAGATGGTGTGAACTCAGCAAGTTATCAACATGACAAGCAACAAATAGAGGTAACGGGGGAAGGGGTTGATGTAGTTGTGCTCACAACTTCGCTTAGAAAAAGCTTGAAGTATGCTGATGTGCTGAGTGTGATCCCTGTGGAGGAGAAAAAGAAAGAGGAAAAGAAGGAGGAGTGTGCCATGGGTTACGTGGTGGCTTATCCTTGGTATGAAGAACCCGCCAGTATCTGCACCATTCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

11.82

Weight (kDa)

6.73

Isoelectric Point (pI)

39.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 297
AclWI GGATC 1 cut(s) 205
AfiI CCNNNNNNNGG 1 cut(s) 220
AgsI TTSAA 1 cut(s) 187
AluBI AGCT 2 cut(s) 59, 183
AluI AGCT 2 cut(s) 59, 183
Alw21I GWGCWC 2 cut(s) 36, 162
Alw44I GTGCAC 1 cut(s) 32
AlwI GGATC 1 cut(s) 205
AlwNI CAGNNNCTG 1 cut(s) 306
ApaLI GTGCAC 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 45
AvaII GGWCC 1 cut(s) 45
BaeGI GKGCMC 1 cut(s) 36
Bbv12I GWGCWC 2 cut(s) 36, 162
BccI CCATC 1 cut(s) 77
BclI TGATCA 1 cut(s) 18
BfmI CTRYAG 1 cut(s) 69
Bme18I GGWCC 1 cut(s) 45
BmgT120I GGNCC 1 cut(s) 45
BsaAI YACGTR 1 cut(s) 268
BsaJI CCNNGG 2 cut(s) 258, 281
Bsc4I CCNNNNNNNGG 1 cut(s) 220
Bse1I ACTGG 1 cut(s) 300
BseDI CCNNGG 2 cut(s) 258, 281
BseLI CCNNNNNNNGG 1 cut(s) 220
BseMII CTCAG 2 cut(s) 108, 194
BseNI ACTGG 1 cut(s) 300
BseRI GAGGAG 2 cut(s) 236, 263
BseSI GKGCMC 1 cut(s) 36
BsgI GTGCAG 1 cut(s) 292
BsiHKAI GWGCWC 2 cut(s) 36, 162
BslI CCNNNNNNNGG 1 cut(s) 220
Bsp1286I GDGCHC 2 cut(s) 36, 162
Bsp143I GATC 2 cut(s) 18, 210
Bsp19I CCATGG 1 cut(s) 258
BspACI CCGC 1 cut(s) 297
BspCNI CTCAG 2 cut(s) 107, 195
BspMAI CTGCAG 1 cut(s) 73
BspPI GGATC 1 cut(s) 205
BsrI ACTGG 1 cut(s) 300
BssECI CCNNGG 2 cut(s) 258, 281
BssMI GATC 2 cut(s) 18, 210
BssT1I CCWWGG 2 cut(s) 258, 281
BstBAI YACGTR 1 cut(s) 268
BstDEI CTNAG 3 cut(s) 94, 173, 203
BstDSI CCRYGG 1 cut(s) 258
BstKTI GATC 2 cut(s) 21, 213
BstMBI GATC 2 cut(s) 18, 210
BstSFI CTRYAG 1 cut(s) 69
BstSLI GKGCMC 1 cut(s) 36
BtgI CCRYGG 1 cut(s) 258
CaiI CAGNNNCTG 1 cut(s) 306
Cfr13I GGNCC 1 cut(s) 45
CviAII CATG 2 cut(s) 110, 259
CviJI RGCY 4 cut(s) 53, 59, 183, 275
CviKI_1 RGCY 4 cut(s) 53, 59, 183, 275
DdeI CTNAG 3 cut(s) 94, 173, 203
DpnI GATC 2 cut(s) 20, 212
DpnII GATC 2 cut(s) 18, 210
Eco130I CCWWGG 2 cut(s) 258, 281
Eco47I GGWCC 1 cut(s) 45
EcoT14I CCWWGG 2 cut(s) 258, 281
ErhI CCWWGG 2 cut(s) 258, 281
FaeI CATG 2 cut(s) 113, 262
FaiI YATR 5 cut(s) 62, 111, 192, 260, 288
FatI CATG 2 cut(s) 109, 258
FauI CCCGC 1 cut(s) 304
FbaI TGATCA 1 cut(s) 18
Hin1II CATG 2 cut(s) 113, 262
HindIII AAGCTT 1 cut(s) 181
Hpy166II GTNNAC 2 cut(s) 34, 91
Hpy188III TCNNGA 1 cut(s) 16
Hpy8I GTNNAC 2 cut(s) 34, 91
HpyAV CCTTC 2 cut(s) 134, 238
HpyCH4IV ACGT 1 cut(s) 267
HpyCH4V TGCA 3 cut(s) 34, 71, 309
HpyF3I CTNAG 3 cut(s) 94, 173, 203
HpySE526I ACGT 1 cut(s) 267
Hsp92II CATG 2 cut(s) 113, 262
Ksp22I TGATCA 1 cut(s) 18
Kzo9I GATC 2 cut(s) 18, 210
LpnPI CCDG 2 cut(s) 228, 313
MaeII ACGT 1 cut(s) 267
MaeIII GTNAC 2 cut(s) 130, 263
MalI GATC 2 cut(s) 20, 212
MboI GATC 2 cut(s) 18, 210
MboII GAAGA 1 cut(s) 302
MhlI GDGCHC 2 cut(s) 36, 162
MnlI CCTC 4 cut(s) 121, 214, 229, 241
NcoI CCATGG 1 cut(s) 258
NdeII GATC 2 cut(s) 18, 210
NlaIII CATG 2 cut(s) 113, 262
Ppu21I YACGTR 1 cut(s) 268
PspPI GGNCC 1 cut(s) 45
PstI CTGCAG 1 cut(s) 73
PstNI CAGNNNCTG 1 cut(s) 306
Sau3AI GATC 2 cut(s) 18, 210
Sau96I GGNCC 1 cut(s) 45
SduI GDGCHC 2 cut(s) 36, 162
SetI ASST 5 cut(s) 15, 61, 132, 185, 270
SfcI CTRYAG 1 cut(s) 69
SinI GGWCC 1 cut(s) 45
SsiI CCGC 1 cut(s) 297
StyI CCWWGG 2 cut(s) 258, 281
TaiI ACGT 1 cut(s) 270
TspDTI ATGAA 4 cut(s) 17, 54, 77, 303
VneI GTGCAC 1 cut(s) 32
VpaK11BI GGWCC 1 cut(s) 45
XcmI CCANNNNNNNNNTGG 1 cut(s) 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.