pycom10g14380

Protein of unknown function (DUF1644)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
OG0002431
Physical Location & Seq
Reverse (-)
17767044 .. 17767992
949 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 372 bp
ATGTATTTGACCGTAGTTGTATGCAAGATGGCTGGTGTGAAACGAAGATTAGATACTGATTCAGATATTTGTGCTCTTAACAAAGAACTGGATGCCGTTTCATGCCCCATCTGCATGGACCATCCACATAATGCCGTTCTCCTGCTTTGTAGCTCGCATGATAAAGGTTGCAGATCGTATATATGTGATACAAGTTACAGGCATTCAAATTGCCTGGACCGTTTTAAAAAGTTGAGGGAAAATACTAGGAACAGTCGAACTCTACCCAGTCCTTTACCTATAAACCGTTATGGTCCTAGTATTACTTCTGATCTGAACATCCCTCTGAGAATAGACTCAAATGAAGCTAATGAAAGTCACAACCCTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1644

Protein Analysis

124

Amino Acids

13.88

Weight (kDa)

7.58

Isoelectric Point (pI)

57.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1644 PF07800 31 - 88 4.9e-30 Protein of unknown function (DUF1644)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 207
AjnI CCWGG 1 cut(s) 213
AluBI AGCT 2 cut(s) 153, 347
AluI AGCT 2 cut(s) 153, 347
Alw21I GWGCWC 1 cut(s) 76
AspS9I GGNCC 3 cut(s) 118, 217, 293
AvaII GGWCC 3 cut(s) 118, 217, 293
BarI GAAGNNNNNNTAC 2 cut(s) 37, 69
Bbv12I GWGCWC 1 cut(s) 76
BccI CCATC 3 cut(s) 22, 116, 129
BceAI ACGGC 2 cut(s) 80, 119
BciT130I CCWGG 1 cut(s) 215
BfaI CTAG 2 cut(s) 246, 297
Bme1390I CCNGG 1 cut(s) 215
Bme18I GGWCC 3 cut(s) 118, 217, 293
BmgT120I GGNCC 3 cut(s) 118, 217, 293
BmrFI CCNGG 1 cut(s) 215
BmrI ACTGGG 1 cut(s) 261
BmsI GCATC 1 cut(s) 82
BmuI ACTGGG 1 cut(s) 261
Bse1I ACTGG 2 cut(s) 93, 267
BseBI CCWGG 1 cut(s) 215
BseGI GGATG 3 cut(s) 97, 121, 318
BseMII CTCAG 1 cut(s) 317
BseNI ACTGG 2 cut(s) 93, 267
BsiHKAI GWGCWC 1 cut(s) 76
BsmI GAATGC 1 cut(s) 202
Bsp1286I GDGCHC 1 cut(s) 76
Bsp143I GATC 2 cut(s) 173, 310
BspCNI CTCAG 1 cut(s) 318
BsrI ACTGG 2 cut(s) 93, 267
BssMI GATC 2 cut(s) 173, 310
Bst2UI CCWGG 1 cut(s) 215
Bst4CI ACNGT 4 cut(s) 13, 221, 254, 287
BstC8I GCNNGC 1 cut(s) 155
BstDEI CTNAG 1 cut(s) 326
BstF5I GGATG 3 cut(s) 97, 121, 318
BstKTI GATC 2 cut(s) 176, 313
BstMBI GATC 2 cut(s) 173, 310
BstMWI GCNNNNNNNGC 1 cut(s) 111
BstNI CCWGG 1 cut(s) 215
BstSCI CCNGG 1 cut(s) 213
BstXI CCANNNNNNTGG 1 cut(s) 115
BtsCI GGATG 3 cut(s) 97, 121, 318
Cac8I GCNNGC 1 cut(s) 155
Cfr13I GGNCC 3 cut(s) 118, 217, 293
CviAII CATG 3 cut(s) 102, 115, 158
CviJI RGCY 3 cut(s) 32, 153, 347
CviKI_1 RGCY 3 cut(s) 32, 153, 347
DdeI CTNAG 1 cut(s) 326
DpnI GATC 2 cut(s) 175, 312
DpnII GATC 2 cut(s) 173, 310
DraI TTTAAA 1 cut(s) 226
Eco47I GGWCC 3 cut(s) 118, 217, 293
EcoRII CCWGG 1 cut(s) 213
FaeI CATG 3 cut(s) 105, 118, 161
FatI CATG 3 cut(s) 101, 114, 157
FokI GGATG 3 cut(s) 104, 108, 305
FspBI CTAG 2 cut(s) 246, 297
Hin1II CATG 3 cut(s) 105, 118, 161
HinfI GANTC 2 cut(s) 59, 335
Hpy188I TCNGA 4 cut(s) 64, 310, 315, 327
HpyCH4III ACNGT 4 cut(s) 13, 221, 254, 287
HpyCH4V TGCA 3 cut(s) 24, 114, 171
HpyF10VI GCNNNNNNNGC 1 cut(s) 111
HpyF3I CTNAG 1 cut(s) 326
Hsp92II CATG 3 cut(s) 105, 118, 161
Kzo9I GATC 2 cut(s) 173, 310
LpnPI CCDG 7 cut(s) 18, 74, 155, 184, 200, 227, 280
LweI GCATC 1 cut(s) 82
MaeI CTAG 2 cut(s) 246, 297
MaeIII GTNAC 2 cut(s) 194, 356
MalI GATC 2 cut(s) 175, 312
MboI GATC 2 cut(s) 173, 310
MboII GAAGA 1 cut(s) 57
MhlI GDGCHC 1 cut(s) 76
MluCI AATT 1 cut(s) 208
MlyI GAGTC 1 cut(s) 329
MnlI CCTC 2 cut(s) 228, 333
MseI TTAA 2 cut(s) 78, 225
MslI CAYNNNNRTG 1 cut(s) 113
MspR9I CCNGG 1 cut(s) 215
Mva1269I GAATGC 1 cut(s) 202
MvaI CCWGG 1 cut(s) 215
MwoI GCNNNNNNNGC 1 cut(s) 111
NdeII GATC 2 cut(s) 173, 310
NlaIII CATG 3 cut(s) 105, 118, 161
NmuCI GTSAC 1 cut(s) 356
PctI GAATGC 1 cut(s) 202
PfeI GAWTC 1 cut(s) 59
PleI GAGTC 1 cut(s) 329
PpsI GAGTC 1 cut(s) 329
Psp6I CCWGG 1 cut(s) 213
PspGI CCWGG 1 cut(s) 213
PspPI GGNCC 3 cut(s) 118, 217, 293
RseI CAYNNNNRTG 1 cut(s) 113
SaqAI TTAA 2 cut(s) 78, 225
Sau3AI GATC 2 cut(s) 173, 310
Sau96I GGNCC 3 cut(s) 118, 217, 293
SchI GAGTC 1 cut(s) 329
ScrFI CCNGG 1 cut(s) 215
SduI GDGCHC 1 cut(s) 76
SetI ASST 4 cut(s) 155, 169, 280, 349
SfaNI GCATC 1 cut(s) 82
SinI GGWCC 3 cut(s) 118, 217, 293
SmiMI CAYNNNNRTG 1 cut(s) 113
Sse9I AATT 1 cut(s) 208
SspMI CTAG 2 cut(s) 246, 297
StyD4I CCNGG 1 cut(s) 213
TaaI ACNGT 4 cut(s) 13, 221, 254, 287
TaqI TCGA 1 cut(s) 256
TasI AATT 1 cut(s) 208
TfiI GAWTC 1 cut(s) 59
Tru1I TTAA 2 cut(s) 78, 225
Tru9I TTAA 2 cut(s) 78, 225
TseFI GTSAC 1 cut(s) 356
Tsp45I GTSAC 1 cut(s) 356
TspDTI ATGAA 3 cut(s) 90, 357, 366
VpaK11BI GGWCC 3 cut(s) 118, 217, 293
XspI CTAG 2 cut(s) 246, 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.