Rmu_sc0006801.1_g000001

Protein of unknown function (DUF1644)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006801.1
Physical Location & Seq
Reverse (-)
2290 .. 3453
1164 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006801.1_g000001.1.cds

Sequence Viewer

Length: 1164 bp
atggctggtgtgaaacgaagaatagatactggttcagatattcgtgctctttacaaagaactggatgctgtttcatgccctatctgcatggaccatccacataatgcagttctcctcctttgcagctcacatgacaagggttgcagatcttacatttgtgatacgagttacaggcattcaaattgcctggaccgttttaaaaagttgagggaaaataatacaaacagtccaactttagtcagttctttacctacaaaccatcatggctctcataataattctgatatggcatcagcaacagatttgaatgaagctaatgaaagtcctaacttgattgaaagcaatgctgtaatatctgccaattcacctggacagccacaggaacgtgttattcaagatctaaatatgccacttctgccagaagaacttttgggagtggctgattccgaatcagttcaggaaagggttgagcatagtgagttggacgtggagaattcctcagagtcaaacttgagcttgaaatgtcctttgtgtcgaggagacatccttggctgggaggttgtggaagattgcagaaagtatcttaatctgaagaagcgaagttgttctcgtgaaggatgctccttttctggtaactaccaggagttgcgtcggcatgcaaggagagttcatcccactactcgaccctcagacgttgacccatctagagagcgagcctggagacaccttgagcaccagagagaatttggtgatgtagttagtgccattcattcagccatgccaggagctgtcgtggttggggattatgttattgaaaatggagataggctagggggtggaggagaaagtggtactggtgaagctaatggcccttggtggactaccatgtttttgtttcagatgattggttcagttgatcgtgctggggaaccgagggcgagggcaagggcttggactagacatcggcggtcagcaggagctttatccgaacgccggttactttggggtgagaatctgttgggtcttcaggatgatgatgatgaagatgatgaggatgatgaggaggaggacaatattctcatgctgaatgacagagatgtatctccaattcccagaaggcgccggcgtttgacaagatctaggtcagatgaagatcgaccatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

387

Amino Acids

43.55

Weight (kDa)

5.39

Isoelectric Point (pI)

63.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 1119
AciI CCGC 1 cut(s) 967
AcsI RAATTY 2 cut(s) 493, 743
AcuI CTGAAG 2 cut(s) 611, 1010
AcyI GRCGYC 1 cut(s) 1120
AfaI GTAC 1 cut(s) 853
AfiI CCNNNNNNNGG 2 cut(s) 553, 993
AflIII ACRYGT 1 cut(s) 385
AgsI TTSAA 6 cut(s) 180, 307, 338, 395, 520, 815
AjiI CACGTC 1 cut(s) 487
AjnI CCWGG 5 cut(s) 186, 367, 639, 716, 781
AluBI AGCT 6 cut(s) 126, 314, 516, 788, 863, 980
AluI AGCT 6 cut(s) 126, 314, 516, 788, 863, 980
Alw21I GWGCWC 2 cut(s) 49, 735
Alw26I GTCTC 2 cut(s) 534, 715
AlwNI CAGNNNCTG 1 cut(s) 788
AoxI GGCC 1 cut(s) 868
ApeKI GCWGC 1 cut(s) 123
ApoI RAATTY 2 cut(s) 493, 743
Asp700I GAANNNNTTC 2 cut(s) 453, 604
AspLEI GCGC 1 cut(s) 1122
AspS9I GGNCC 3 cut(s) 91, 190, 869
AsuHPI GGTGA 4 cut(s) 357, 761, 869, 1019
AvaII GGWCC 2 cut(s) 91, 190
BanI GGYRCC 1 cut(s) 1119
BarI GAAGNNNNNNTAC 2 cut(s) 10, 42
BauI CACGAG 1 cut(s) 609
BbsI GAAGAC 1 cut(s) 1016
Bbv12I GWGCWC 2 cut(s) 49, 735
BbvI GCAGC 1 cut(s) 135
BccI CCATC 3 cut(s) 102, 267, 709
BciT130I CCWGG 5 cut(s) 188, 369, 641, 718, 783
BcoDI GTCTC 2 cut(s) 534, 715
BfaI CTAG 4 cut(s) 705, 830, 957, 1140
BfoI RGCGCY 1 cut(s) 1123
BglII AGATCT 3 cut(s) 146, 397, 1136
BisI GCNGC 1 cut(s) 124
BlsI GCNGC 1 cut(s) 125
Bme1390I CCNGG 5 cut(s) 188, 369, 641, 718, 783
Bme18I GGWCC 2 cut(s) 91, 190
BmgBI CACGTC 1 cut(s) 487
BmgT120I GGNCC 3 cut(s) 91, 190, 869
BmiI GGNNCC 2 cut(s) 930, 1121
BmrFI CCNGG 5 cut(s) 188, 369, 641, 718, 783
BmsI GCATC 3 cut(s) 55, 299, 608
BpiI GAAGAC 1 cut(s) 1016
BplI GAGNNNNNCTC 2 cut(s) 482, 514
BpmI CTGGAG 1 cut(s) 739
BpuEI CTTGAG 2 cut(s) 532, 749
BsaBI GATNNNNATC 1 cut(s) 1152
BsaHI GRCGYC 1 cut(s) 1120
BsaJI CCNNGG 3 cut(s) 547, 872, 932
BsaXI ACNNNNNCTCC 2 cut(s) 777, 807
Bsc4I CCNNNNNNNGG 2 cut(s) 553, 993
Bse118I RCCGGY 2 cut(s) 993, 1122
Bse1I ACTGG 3 cut(s) 34, 66, 859
Bse3DI GCAATG 1 cut(s) 349
Bse8I GATNNNNATC 1 cut(s) 1152
BseBI CCWGG 5 cut(s) 188, 369, 641, 718, 783
BseDI CCNNGG 3 cut(s) 547, 872, 932
BseGI GGATG 7 cut(s) 70, 94, 543, 623, 670, 1036, 1060
BseJI GATNNNNATC 1 cut(s) 1152
BseLI CCNNNNNNNGG 2 cut(s) 553, 993
BseMI GCAATG 1 cut(s) 349
BseMII CTCAG 2 cut(s) 513, 702
BseNI ACTGG 3 cut(s) 34, 66, 859
BseRI GAGGAG 5 cut(s) 104, 552, 855, 1076, 1079
BseXI GCAGC 1 cut(s) 135
BseYI CCCAGC 2 cut(s) 552, 923
BshFI GGCC 1 cut(s) 870
BshNI GGYRCC 1 cut(s) 1119
BsiHKAI GWGCWC 2 cut(s) 49, 735
BsiSI CCGG 2 cut(s) 994, 1123
BslI CCNNNNNNNGG 2 cut(s) 553, 993
BsmAI GTCTC 2 cut(s) 534, 715
BsmI GAATGC 1 cut(s) 175
BsnI GGCC 1 cut(s) 870
Bsp1286I GDGCHC 2 cut(s) 49, 735
Bsp143I GATC 5 cut(s) 146, 397, 916, 1136, 1153
BspACI CCGC 1 cut(s) 967
BspANI GGCC 1 cut(s) 870
BspCNI CTCAG 2 cut(s) 512, 701
BspLI GGNNCC 2 cut(s) 930, 1121
BspT107I GGYRCC 1 cut(s) 1119
BsrDI GCAATG 1 cut(s) 349
BsrFI RCCGGY 2 cut(s) 993, 1122
BsrI ACTGG 3 cut(s) 34, 66, 859
BssAI RCCGGY 2 cut(s) 993, 1122
BssECI CCNNGG 3 cut(s) 547, 872, 932
BssMI GATC 5 cut(s) 146, 397, 916, 1136, 1153
BssNI GRCGYC 1 cut(s) 1120
BssSI CACGAG 1 cut(s) 609
BssT1I CCWWGG 2 cut(s) 547, 872
Bst2BI CACGAG 1 cut(s) 609
Bst2UI CCWGG 5 cut(s) 188, 369, 641, 718, 783
Bst4CI ACNGT 2 cut(s) 194, 227
BstACI GRCGYC 1 cut(s) 1120
BstC8I GCNNGC 3 cut(s) 657, 714, 1124
BstDEI CTNAG 2 cut(s) 499, 688
BstF5I GGATG 7 cut(s) 70, 94, 543, 623, 670, 1036, 1060
BstH2I RGCGCY 1 cut(s) 1123
BstHHI GCGC 1 cut(s) 1122
BstKTI GATC 5 cut(s) 149, 400, 919, 1139, 1156
BstMAI GTCTC 2 cut(s) 534, 715
BstMBI GATC 5 cut(s) 146, 397, 916, 1136, 1153
BstMWI GCNNNNNNNGC 2 cut(s) 84, 415
BstNI CCWGG 5 cut(s) 188, 369, 641, 718, 783
BstNSI RCATGY 1 cut(s) 659
BstSCI CCNGG 5 cut(s) 186, 367, 639, 716, 781
BstV1I GCAGC 1 cut(s) 135
BstV2I GAAGAC 1 cut(s) 1016
BstX2I RGATCY 3 cut(s) 146, 397, 1136
BstYI RGATCY 3 cut(s) 146, 397, 1136
BsuRI GGCC 1 cut(s) 870
BtrI CACGTC 1 cut(s) 487
BtsCI GGATG 7 cut(s) 70, 94, 543, 623, 670, 1036, 1060
Cac8I GCNNGC 3 cut(s) 657, 714, 1124
CaiI CAGNNNCTG 1 cut(s) 788
CfoI GCGC 1 cut(s) 1122
Cfr10I RCCGGY 2 cut(s) 993, 1122
Cfr13I GGNCC 3 cut(s) 91, 190, 869
CseI GACGC 1 cut(s) 638
Csp6I GTAC 1 cut(s) 852
CviAII CATG 9 cut(s) 75, 88, 131, 263, 656, 778, 886, 1081, 1161
CviQI GTAC 1 cut(s) 852
DdeI CTNAG 2 cut(s) 499, 688
DinI GGCGCC 1 cut(s) 1121
DpnI GATC 5 cut(s) 148, 399, 918, 1138, 1155
DpnII GATC 5 cut(s) 146, 397, 916, 1136, 1153
DraI TTTAAA 1 cut(s) 199
Eco130I CCWWGG 2 cut(s) 547, 872
Eco47I GGWCC 2 cut(s) 91, 190
Eco57I CTGAAG 2 cut(s) 611, 1010
EcoRI GAATTC 1 cut(s) 493
EcoRII CCWGG 5 cut(s) 186, 367, 639, 716, 781
EcoT14I CCWWGG 2 cut(s) 547, 872
EgeI GGCGCC 1 cut(s) 1121
EheI GGCGCC 1 cut(s) 1121
ErhI CCWWGG 2 cut(s) 547, 872
FaeI CATG 9 cut(s) 78, 91, 134, 266, 659, 781, 889, 1084, 1164
FatI CATG 9 cut(s) 74, 87, 130, 262, 655, 777, 885, 1080, 1160
Fnu4HI GCNGC 1 cut(s) 124
FokI GGATG 7 cut(s) 77, 81, 530, 630, 657, 1043, 1067
Fsp4HI GCNGC 1 cut(s) 124
FspBI CTAG 4 cut(s) 705, 830, 957, 1140
GlaI GCGC 1 cut(s) 1121
GluI GCNGC 1 cut(s) 124
GsaI CCCAGC 2 cut(s) 556, 927
GsuI CTGGAG 1 cut(s) 739
HaeII RGCGCY 1 cut(s) 1123
HaeIII GGCC 1 cut(s) 870
HapII CCGG 2 cut(s) 994, 1123
HgaI GACGC 1 cut(s) 638
HhaI GCGC 1 cut(s) 1122
Hin1I GRCGYC 1 cut(s) 1120
Hin1II CATG 9 cut(s) 78, 91, 134, 266, 659, 781, 889, 1084, 1164
Hin6I GCGC 1 cut(s) 1120
HinP1I GCGC 1 cut(s) 1120
HincII GTYRAC 1 cut(s) 697
HindII GTYRAC 1 cut(s) 697
HinfI GANTC 4 cut(s) 443, 449, 503, 1012
HpaII CCGG 2 cut(s) 994, 1123
HphI GGTGA 4 cut(s) 357, 761, 869, 1019
Hpy166II GTNNAC 2 cut(s) 697, 879
Hpy188I TCNGA 9 cut(s) 37, 283, 448, 502, 591, 691, 900, 988, 1147
Hpy188III TCNNGA 5 cut(s) 395, 458, 611, 705, 1028
Hpy8I GTNNAC 2 cut(s) 697, 879
Hpy99I CGWCG 1 cut(s) 654
HpyAV CCTTC 2 cut(s) 608, 1110
HpyCH4III ACNGT 2 cut(s) 194, 227
HpyCH4IV ACGT 3 cut(s) 385, 486, 693
HpyCH4V TGCA 6 cut(s) 87, 107, 123, 144, 573, 659
HpyF10VI GCNNNNNNNGC 2 cut(s) 84, 415
HpyF3I CTNAG 2 cut(s) 499, 688
HpySE526I ACGT 3 cut(s) 385, 486, 693
Hsp92I GRCGYC 1 cut(s) 1120
Hsp92II CATG 9 cut(s) 78, 91, 134, 266, 659, 781, 889, 1084, 1164
HspAI GCGC 1 cut(s) 1120
KasI GGCGCC 1 cut(s) 1119
KroI GCCGGC 1 cut(s) 1122
KroNI GCCGGC 1 cut(s) 1124
Kzo9I GATC 5 cut(s) 146, 397, 916, 1136, 1153
LmnI GCTCC 3 cut(s) 626, 785, 977
Lsp1109I GCAGC 1 cut(s) 135
LweI GCATC 3 cut(s) 55, 299, 608
MaeI CTAG 4 cut(s) 705, 830, 957, 1140
MaeII ACGT 3 cut(s) 385, 486, 693
MaeIII GTNAC 3 cut(s) 167, 632, 996
MalI GATC 5 cut(s) 148, 399, 918, 1138, 1155
MboI GATC 5 cut(s) 146, 397, 916, 1136, 1153
MboII GAAGA 7 cut(s) 30, 434, 578, 604, 1016, 1055, 1163
MflI RGATCY 3 cut(s) 146, 397, 1136
MhlI GDGCHC 2 cut(s) 49, 735
MluCI AATT 6 cut(s) 181, 277, 361, 493, 743, 1107
Mly113I GGCGCC 1 cut(s) 1120
MlyI GAGTC 1 cut(s) 512
MmeI TCCRAC 2 cut(s) 254, 462
MreI CGCCGGCG 1 cut(s) 1122
MroNI GCCGGC 1 cut(s) 1122
MroXI GAANNNNTTC 2 cut(s) 453, 604
MseI TTAA 2 cut(s) 198, 585
MspI CCGG 2 cut(s) 994, 1123
MspR9I CCNGG 5 cut(s) 188, 369, 641, 718, 783
Mva1269I GAATGC 1 cut(s) 175
MvaI CCWGG 5 cut(s) 188, 369, 641, 718, 783
MwoI GCNNNNNNNGC 2 cut(s) 84, 415
NaeI GCCGGC 1 cut(s) 1124
NarI GGCGCC 1 cut(s) 1120
NdeII GATC 2 cut(s) 146, 397
NgoMIV GCCGGC 1 cut(s) 1122
NlaIII CATG 9 cut(s) 78, 91, 134, 266, 659, 781, 889, 1084, 1164
NlaIV GGNNCC 2 cut(s) 930, 1121
NspI RCATGY 1 cut(s) 659
PaeI GCATGC 1 cut(s) 659
PctI GAATGC 1 cut(s) 175
PdiI GCCGGC 1 cut(s) 1124
PdmI GAANNNNTTC 2 cut(s) 453, 604
PfeI GAWTC 3 cut(s) 443, 449, 1012
PkrI GCNGC 1 cut(s) 125
PleI GAGTC 1 cut(s) 511
PluTI GGCGCC 1 cut(s) 1123
PpsI GAGTC 1 cut(s) 511
Psp6I CCWGG 5 cut(s) 186, 367, 639, 716, 781
PspFI CCCAGC 2 cut(s) 552, 923
PspGI CCWGG 5 cut(s) 186, 367, 639, 716, 781
PspN4I GGNNCC 2 cut(s) 930, 1121
PspPI GGNCC 3 cut(s) 91, 190, 869
PsrI GAACNNNNNNTAC 2 cut(s) 981, 1013
PstNI CAGNNNCTG 1 cut(s) 788
PsuI RGATCY 3 cut(s) 146, 397, 1136
RsaI GTAC 1 cut(s) 853
RsaNI GTAC 1 cut(s) 852
SaqAI TTAA 2 cut(s) 198, 585
SatI GCNGC 1 cut(s) 124
Sau3AI GATC 5 cut(s) 146, 397, 916, 1136, 1153
Sau96I GGNCC 3 cut(s) 91, 190, 869
SchI GAGTC 1 cut(s) 512
ScrFI CCNGG 5 cut(s) 188, 369, 641, 718, 783
SduI GDGCHC 2 cut(s) 49, 735
SfaNI GCATC 3 cut(s) 55, 299, 608
SfoI GGCGCC 1 cut(s) 1121
SgrAI CRCCGGYG 1 cut(s) 1122
SinI GGWCC 2 cut(s) 91, 190
SmlI CTYRAG 2 cut(s) 511, 728
SmoI CTYRAG 2 cut(s) 511, 728
SphI GCATGC 1 cut(s) 659
Sse9I AATT 6 cut(s) 181, 277, 361, 493, 743, 1107
SsiI CCGC 1 cut(s) 967
SspDI GGCGCC 1 cut(s) 1119
SspI AATATT 1 cut(s) 1075
SspMI CTAG 4 cut(s) 705, 830, 957, 1140
StyD4I CCNGG 5 cut(s) 186, 367, 639, 716, 781
StyI CCWWGG 2 cut(s) 547, 872
TaaI ACNGT 2 cut(s) 194, 227
TaiI ACGT 3 cut(s) 388, 489, 696
TaqI TCGA 3 cut(s) 535, 682, 1156
TasI AATT 6 cut(s) 181, 277, 361, 493, 743, 1107
TfiI GAWTC 3 cut(s) 443, 449, 1012
Tru1I TTAA 2 cut(s) 198, 585
Tru9I TTAA 2 cut(s) 198, 585
TseI GCWGC 1 cut(s) 123
TspDTI ATGAA 7 cut(s) 63, 324, 333, 659, 758, 1056, 1164
VpaK11BI GGWCC 2 cut(s) 91, 190
XapI RAATTY 2 cut(s) 493, 743
XbaI TCTAGA 1 cut(s) 704
XceI RCATGY 1 cut(s) 659
XcmI CCANNNNNNNNNTGG 1 cut(s) 743
XmnI GAANNNNTTC 2 cut(s) 453, 604
XspI CTAG 4 cut(s) 705, 830, 957, 1140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.