pycom11g23400

hAT family C-terminal dimerisation region

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Reverse (-)
26401757 .. 26401948
192 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGAAGTGGCAATCTCATATAGTTCAAAGGTTTATTCTCGAACTTCTTGTACGGGGCTCTATCACTTTCTGCGTTAGTTTTACATTTTCCGAATACAAAGCTCATTTGGGATTCAGAGCGATTTATGACATAATAGAACTGGAATTCAGAAGCTATTGCGAGTTCATGTTGCCTAGTTTTCTGTTTAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.59

Weight (kDa)

6.7

Isoelectric Point (pI)

52.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 143
AfaI GTAC 1 cut(s) 51
AgsI TTSAA 1 cut(s) 26
AluBI AGCT 3 cut(s) 101, 153, 189
AluI AGCT 3 cut(s) 101, 153, 189
ApoI RAATTY 1 cut(s) 143
BanII GRGCYC 1 cut(s) 59
BfaI CTAG 1 cut(s) 174
Bse1I ACTGG 1 cut(s) 144
BseNI ACTGG 1 cut(s) 144
Bsp1286I GDGCHC 1 cut(s) 59
BsrI ACTGG 1 cut(s) 144
Csp6I GTAC 1 cut(s) 50
CviAII CATG 1 cut(s) 166
CviJI RGCY 4 cut(s) 57, 101, 153, 189
CviKI_1 RGCY 4 cut(s) 57, 101, 153, 189
CviQI GTAC 1 cut(s) 50
Eco24I GRGCYC 1 cut(s) 59
EcoRI GAATTC 1 cut(s) 143
EcoT38I GRGCYC 1 cut(s) 59
FaeI CATG 1 cut(s) 169
FaiI YATR 5 cut(s) 18, 20, 126, 131, 167
FatI CATG 1 cut(s) 165
FriOI GRGCYC 1 cut(s) 59
FspBI CTAG 1 cut(s) 174
FspEI CC 9 cut(s) 13, 37, 38, 39, 92, 93, 103, 125, 186
Hin1II CATG 1 cut(s) 169
HinfI GANTC 1 cut(s) 111
Hpy188I TCNGA 3 cut(s) 91, 116, 149
Hpy188III TCNNGA 1 cut(s) 38
Hsp92II CATG 1 cut(s) 169
LpnPI CCDG 1 cut(s) 125
MaeI CTAG 1 cut(s) 174
MhlI GDGCHC 1 cut(s) 59
MluCI AATT 1 cut(s) 143
NlaIII CATG 1 cut(s) 169
PfeI GAWTC 1 cut(s) 111
PsrI GAACNNNNNNTAC 2 cut(s) 33, 65
RsaI GTAC 1 cut(s) 51
RsaNI GTAC 1 cut(s) 50
SduI GDGCHC 1 cut(s) 59
SetI ASST 4 cut(s) 32, 103, 155, 191
SgeI CNNG 7 cut(s) 50, 59, 65, 152, 172, 178, 186
Sse9I AATT 1 cut(s) 143
SspMI CTAG 1 cut(s) 174
TaqI TCGA 1 cut(s) 39
TasI AATT 1 cut(s) 143
TfiI GAWTC 1 cut(s) 111
TspDTI ATGAA 2 cut(s) 17, 154
XapI RAATTY 1 cut(s) 143
XspI CTAG 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.