Rh6BG199100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
37529132 .. 37531379
2248 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG199100.1

Sequence Viewer

Length: 309 bp
ATGGACTCTGGGGATGATTTGAATTTGGGTGAGTACTATGATAATATAGATATGTTTCCACAACCAAACCCTGAGAATATGCCATATGAGTCTTCGGGTTCAAGTGAACCACAACCTACATCTCAAAATGATAATAGCCAACCTAATGAGGTTGGCACTGAACCTACTGATCCCAACAAAGAAGATGTGGTAAGAAAAAGAAAACGGAAGTCTGATGTGTGGGATCATTACAAAGTTGAGGAAATTGATATTGGTGGAGGTAAAAAAGATGAAAGGGCATTGATTAAGAAAGCTAAGCTACATCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.63

Weight (kDa)

4.77

Isoelectric Point (pI)

69.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 164, 231
AcsI RAATTY 1 cut(s) 22
AfaI GTAC 1 cut(s) 35
AgsI TTSAA 2 cut(s) 22, 102
AjuI GAANNNNNNNTTGG 2 cut(s) 234, 266
AluBI AGCT 2 cut(s) 293, 298
AluI AGCT 2 cut(s) 293, 298
AlwI GGATC 2 cut(s) 164, 231
ApoI RAATTY 1 cut(s) 22
AsuHPI GGTGA 1 cut(s) 41
BbsI GAAGAC 1 cut(s) 84
BlpI GCTNAGC 1 cut(s) 294
BmcAI AGTACT 1 cut(s) 35
BpiI GAAGAC 1 cut(s) 84
Bpu1102I GCTNAGC 1 cut(s) 294
BseGI GGATG 1 cut(s) 19
BseMII CTCAG 1 cut(s) 63
Bsp143I GATC 2 cut(s) 169, 223
Bsp1720I GCTNAGC 1 cut(s) 294
BspCNI CTCAG 1 cut(s) 64
BspPI GGATC 2 cut(s) 164, 231
BssMI GATC 2 cut(s) 169, 223
BstDEI CTNAG 2 cut(s) 72, 294
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 2 cut(s) 172, 226
BstMBI GATC 2 cut(s) 169, 223
BstV2I GAAGAC 1 cut(s) 84
BtsCI GGATG 1 cut(s) 19
BtsIMutI CAGTG 2 cut(s) 156, 304
Csp6I GTAC 1 cut(s) 34
CviJI RGCY 3 cut(s) 138, 293, 298
CviKI_1 RGCY 3 cut(s) 138, 293, 298
CviQI GTAC 1 cut(s) 34
DdeI CTNAG 2 cut(s) 72, 294
DpnI GATC 2 cut(s) 171, 225
DpnII GATC 2 cut(s) 169, 223
FaiI YATR 6 cut(s) 39, 47, 53, 80, 85, 87
FauNDI CATATG 1 cut(s) 85
FokI GGATG 1 cut(s) 26
HinfI GANTC 2 cut(s) 5, 89
HphI GGTGA 1 cut(s) 41
Hpy166II GTNNAC 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 214
Hpy8I GTNNAC 1 cut(s) 107
HpyF3I CTNAG 2 cut(s) 72, 294
Kzo9I GATC 2 cut(s) 169, 223
LpnPI CCDG 1 cut(s) 84
MalI GATC 2 cut(s) 171, 225
MboI GATC 2 cut(s) 169, 223
MboII GAAGA 2 cut(s) 84, 194
MluCI AATT 2 cut(s) 22, 243
MlyI GAGTC 1 cut(s) 98
MnlI CCTC 3 cut(s) 142, 232, 251
MseI TTAA 1 cut(s) 285
NdeI CATATG 1 cut(s) 85
NdeII GATC 2 cut(s) 169, 223
PleI GAGTC 1 cut(s) 97
PpsI GAGTC 1 cut(s) 97
RsaI GTAC 1 cut(s) 35
RsaNI GTAC 1 cut(s) 34
SaqAI TTAA 1 cut(s) 285
Sau3AI GATC 2 cut(s) 169, 223
ScaI AGTACT 1 cut(s) 35
SchI GAGTC 1 cut(s) 98
SetI ASST 7 cut(s) 118, 145, 153, 166, 262, 295, 300
SgeI CNNG 4 cut(s) 21, 83, 108, 114
Sse9I AATT 2 cut(s) 22, 243
TasI AATT 2 cut(s) 22, 243
TatI WGTACW 1 cut(s) 33
Tru1I TTAA 1 cut(s) 285
Tru9I TTAA 1 cut(s) 285
TscAI CASTG 1 cut(s) 163
TspDTI ATGAA 1 cut(s) 285
TspGWI ACGGA 1 cut(s) 220
TspRI CASTG 1 cut(s) 163
XapI RAATTY 1 cut(s) 22
ZrmI AGTACT 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.