pycom12g16070

Phosphoinositide phosphatase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
18496154 .. 18501270
5117 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g16070.4

Sequence Viewer

Length: 357 bp
ATGAGGTTTCTGTCCTGCAACGAGGGTATGAAGAATTCAACTGCTCAGGAGAAAAAGGATGAGGCGTACTTCATGGCTCTGTTGAAAACAGTCCAATCAAATCTGGGGCTGTACTTCTCGTACGAGACTGATATAACACTAAAAAGATGTAAGTTAGTGGAAAGATGGATGGCCAAATCAATATGGAAGCAGGCCGACCCTCGATTTGTTTGGAACATAAATCTTTTGGACGAACTTATCGAGTATAAGCTTGATGGGTTCATTATTCCTCTAGTACAAGGAAATATCCTGAATTTACTGATTTCTTATGTGTATATCCCTCTCTCTCTCTCTCTAAGGTTGAGATTCAGAGTTTAG

Protein Analysis

119

Amino Acids

13.95

Weight (kDa)

9.14

Isoelectric Point (pI)

41.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 171
AcsI RAATTY 2 cut(s) 34, 292
AfaI GTAC 4 cut(s) 68, 113, 122, 276
AgsI TTSAA 2 cut(s) 39, 85
AluBI AGCT 1 cut(s) 250
AluI AGCT 1 cut(s) 250
Alw26I GTCTC 1 cut(s) 119
AoxI GGCC 2 cut(s) 171, 192
ApoI RAATTY 2 cut(s) 34, 292
ArsI GACNNNNNNTTYG 2 cut(s) 188, 220
BalI TGGCCA 1 cut(s) 173
BccI CCATC 3 cut(s) 159, 163, 248
BcoDI GTCTC 1 cut(s) 119
BfaI CTAG 1 cut(s) 272
Bpu10I CCTNAGC 1 cut(s) 45
BseGI GGATG 2 cut(s) 64, 174
BseMII CTCAG 1 cut(s) 59
BshFI GGCC 2 cut(s) 173, 194
BsiWI CGTACG 1 cut(s) 120
BsmAI GTCTC 1 cut(s) 119
BsnI GGCC 2 cut(s) 173, 194
BspANI GGCC 2 cut(s) 173, 194
BspCNI CTCAG 1 cut(s) 58
Bst4CI ACNGT 1 cut(s) 91
BstC8I GCNNGC 1 cut(s) 192
BstDEI CTNAG 2 cut(s) 45, 335
BstF5I GGATG 2 cut(s) 64, 174
BstMAI GTCTC 1 cut(s) 119
BsuRI GGCC 2 cut(s) 173, 194
BtsCI GGATG 2 cut(s) 64, 174
Cac8I GCNNGC 1 cut(s) 192
Csp6I GTAC 4 cut(s) 67, 112, 121, 275
CviAII CATG 1 cut(s) 73
CviJI RGCY 5 cut(s) 77, 109, 173, 194, 250
CviKI_1 RGCY 5 cut(s) 77, 109, 173, 194, 250
CviQI GTAC 4 cut(s) 67, 112, 121, 275
DdeI CTNAG 2 cut(s) 45, 335
EaeI YGGCCR 1 cut(s) 171
EcoRI GAATTC 1 cut(s) 34
FaeI CATG 1 cut(s) 76
FaiI YATR 8 cut(s) 29, 74, 134, 184, 218, 246, 309, 315
FatI CATG 1 cut(s) 72
FokI GGATG 2 cut(s) 71, 181
FspBI CTAG 1 cut(s) 272
HaeIII GGCC 2 cut(s) 173, 194
Hin1II CATG 1 cut(s) 76
HindIII AAGCTT 1 cut(s) 248
HinfI GANTC 1 cut(s) 345
Hpy188I TCNGA 1 cut(s) 350
Hpy188III TCNNGA 2 cut(s) 47, 289
HpyCH4III ACNGT 1 cut(s) 91
HpyCH4V TGCA 1 cut(s) 18
HpyF3I CTNAG 2 cut(s) 45, 335
Hsp92II CATG 1 cut(s) 76
LpnPI CCDG 5 cut(s) 28, 32, 89, 176, 302
MaeI CTAG 1 cut(s) 272
MboII GAAGA 1 cut(s) 43
MlsI TGGCCA 1 cut(s) 173
MluCI AATT 2 cut(s) 34, 292
MluNI TGGCCA 1 cut(s) 173
MnlI CCTC 5 cut(s) 16, 55, 210, 279, 330
Mox20I TGGCCA 1 cut(s) 173
MscI TGGCCA 1 cut(s) 173
Msp20I TGGCCA 1 cut(s) 173
NlaIII CATG 1 cut(s) 76
PcsI WCGNNNNNNNCGW 1 cut(s) 237
PfeI GAWTC 1 cut(s) 345
Pfl23II CGTACG 1 cut(s) 120
PspLI CGTACG 1 cut(s) 120
RsaI GTAC 4 cut(s) 68, 113, 122, 276
RsaNI GTAC 4 cut(s) 67, 112, 121, 275
SetI ASST 3 cut(s) 8, 252, 341
Sse9I AATT 2 cut(s) 34, 292
SspMI CTAG 1 cut(s) 272
TaaI ACNGT 1 cut(s) 91
TaqI TCGA 2 cut(s) 202, 240
TasI AATT 2 cut(s) 34, 292
TatI WGTACW 2 cut(s) 111, 274
TfiI GAWTC 1 cut(s) 345
TspDTI ATGAA 3 cut(s) 44, 61, 250
XapI RAATTY 2 cut(s) 34, 292
XspI CTAG 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.