Rmu_co8257277.1_g000001

Phosphoinositide phosphatase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8257277.1
Physical Location & Seq
Forward (+)
1 .. 716
716 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8257277.1_g000001.1.cds

Sequence Viewer

Length: 302 bp
gaaattacttgcttgtaataacttctcggatagaagttgggaactatcttggcttccctgtttaccgggtgacttctatgaagtttctttcctgcaatgaggtgttgaagctctcaactgctcaagaaaaaaaagatgaagcttacttcatggctttgttgaaaacagtccaatcaactccagggctgtacttttcatatgaaacagatttaacattaaactttcagagaagacgcaagttgattgaaggttggatgggcaaaccattatggaagcaggttggtggaaactcggaattatga

Protein Analysis

99

Amino Acids

11.46

Weight (kDa)

9.3

Isoelectric Point (pI)

43.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 267
AfaI GTAC 1 cut(s) 190
AgsI TTSAA 3 cut(s) 108, 162, 247
AjnI CCWGG 1 cut(s) 180
AluBI AGCT 2 cut(s) 111, 142
AluI AGCT 2 cut(s) 111, 142
AsuC2I CCSGG 1 cut(s) 67
AsuHPI GGTGA 1 cut(s) 81
BbsI GAAGAC 1 cut(s) 237
BccI CCATC 1 cut(s) 249
BciT130I CCWGG 1 cut(s) 182
BcnI CCSGG 1 cut(s) 67
BfuAI ACCTGC 1 cut(s) 267
Bme1390I CCNGG 2 cut(s) 67, 182
BmrFI CCNGG 2 cut(s) 67, 182
BpiI GAAGAC 1 cut(s) 237
BpmI CTGGAG 1 cut(s) 164
BpuEI CTTGAG 1 cut(s) 107
BpuMI CCSGG 1 cut(s) 67
BsaJI CCNNGG 1 cut(s) 181
Bse3DI GCAATG 1 cut(s) 102
BseBI CCWGG 1 cut(s) 182
BseDI CCNNGG 1 cut(s) 181
BseGI GGATG 1 cut(s) 260
BseMI GCAATG 1 cut(s) 102
BsiSI CCGG 1 cut(s) 66
BspMI ACCTGC 1 cut(s) 267
BsrDI GCAATG 1 cut(s) 102
BssECI CCNNGG 1 cut(s) 181
Bst2UI CCWGG 1 cut(s) 182
Bst4CI ACNGT 1 cut(s) 168
BstF5I GGATG 1 cut(s) 260
BstNI CCWGG 1 cut(s) 182
BstSCI CCNGG 2 cut(s) 65, 180
BstV2I GAAGAC 1 cut(s) 237
BtsCI GGATG 1 cut(s) 260
BveI ACCTGC 1 cut(s) 267
CseI GACGC 1 cut(s) 242
Csp6I GTAC 1 cut(s) 189
CviAII CATG 1 cut(s) 150
CviJI RGCY 5 cut(s) 53, 111, 142, 154, 186
CviKI_1 RGCY 5 cut(s) 53, 111, 142, 154, 186
CviQI GTAC 1 cut(s) 189
EcoRII CCWGG 1 cut(s) 180
FaeI CATG 1 cut(s) 153
FaiI YATR 6 cut(s) 79, 151, 198, 200, 270, 300
FatI CATG 1 cut(s) 149
FauNDI CATATG 1 cut(s) 198
FokI GGATG 1 cut(s) 267
GsuI CTGGAG 1 cut(s) 164
HapII CCGG 1 cut(s) 66
HgaI GACGC 1 cut(s) 242
Hin1II CATG 1 cut(s) 153
HindIII AAGCTT 1 cut(s) 140
HpaII CCGG 1 cut(s) 66
HphI GGTGA 1 cut(s) 81
Hpy166II GTNNAC 1 cut(s) 63
Hpy188I TCNGA 3 cut(s) 29, 227, 294
Hpy188III TCNNGA 1 cut(s) 124
Hpy8I GTNNAC 1 cut(s) 63
HpyAV CCTTC 1 cut(s) 241
HpyCH4III ACNGT 1 cut(s) 168
HpyCH4V TGCA 1 cut(s) 95
Hsp92II CATG 1 cut(s) 153
LpnPI CCDG 6 cut(s) 71, 79, 105, 167, 194, 262
MaeIII GTNAC 1 cut(s) 69
MboII GAAGA 1 cut(s) 242
MluCI AATT 2 cut(s) 3, 295
MmeI TCCRAC 1 cut(s) 232
MnlI CCTC 1 cut(s) 93
MseI TTAA 2 cut(s) 211, 217
MspI CCGG 1 cut(s) 66
MspR9I CCNGG 2 cut(s) 67, 182
MvaI CCWGG 1 cut(s) 182
NciI CCSGG 1 cut(s) 67
NdeI CATATG 1 cut(s) 198
NlaIII CATG 1 cut(s) 153
NmuCI GTSAC 1 cut(s) 69
Psp6I CCWGG 1 cut(s) 180
PspGI CCWGG 1 cut(s) 180
RsaI GTAC 1 cut(s) 190
RsaNI GTAC 1 cut(s) 189
SaqAI TTAA 2 cut(s) 211, 217
ScrFI CCNGG 2 cut(s) 67, 182
SetI ASST 5 cut(s) 104, 113, 144, 252, 281
SmlI CTYRAG 1 cut(s) 122
SmoI CTYRAG 1 cut(s) 122
Sse9I AATT 2 cut(s) 3, 295
StyD4I CCNGG 2 cut(s) 65, 180
TaaI ACNGT 1 cut(s) 168
TasI AATT 2 cut(s) 3, 295
TatI WGTACW 1 cut(s) 188
Tru1I TTAA 2 cut(s) 211, 217
Tru9I TTAA 2 cut(s) 211, 217
TseFI GTSAC 1 cut(s) 69
Tsp45I GTSAC 1 cut(s) 69
TspDTI ATGAA 5 cut(s) 94, 138, 152, 185, 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.