RchiOBHm_Chr7g0208621

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
26014907 .. 26016909
2003 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18672

Sequence Viewer

Length: 189 bp
ATGTATGGACATTTCAAGAAGCTGGATGAAGAGATTAAAAGGAGAGCTGCATCTTTGGAAGTAGAAGCCCAACTATCTCAGGTTTGCAATTGTCGATCACTTCATATTATGGAATTGATATACGATAAATCAAGAAGCTGCATAAACTATCTGTTAGCCAGAACTTTGACCACTATATTTGAAATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.29

Weight (kDa)

7.74

Isoelectric Point (pI)

64.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 183
AgsI TTSAA 2 cut(s) 16, 182
AluBI AGCT 3 cut(s) 22, 47, 138
AluI AGCT 3 cut(s) 22, 47, 138
ApeKI GCWGC 2 cut(s) 47, 138
ApoI RAATTY 1 cut(s) 183
BbvI GCAGC 2 cut(s) 34, 125
BisI GCNGC 2 cut(s) 48, 139
BlsI GCNGC 2 cut(s) 49, 140
BmsI GCATC 1 cut(s) 59
BseGI GGATG 1 cut(s) 31
BseMII CTCAG 1 cut(s) 92
BseXI GCAGC 2 cut(s) 34, 125
Bsp143I GATC 1 cut(s) 95
BspCNI CTCAG 1 cut(s) 91
BssMI GATC 1 cut(s) 95
Bst6I CTCTTC 1 cut(s) 24
BstDEI CTNAG 1 cut(s) 78
BstF5I GGATG 1 cut(s) 31
BstKTI GATC 1 cut(s) 98
BstMBI GATC 1 cut(s) 95
BstV1I GCAGC 2 cut(s) 34, 125
BtsCI GGATG 1 cut(s) 31
CspCI CAANNNNNGTGG 1 cut(s) 160
CviJI RGCY 5 cut(s) 22, 47, 68, 138, 158
CviKI_1 RGCY 5 cut(s) 22, 47, 68, 138, 158
DdeI CTNAG 1 cut(s) 78
DpnI GATC 1 cut(s) 97
DpnII GATC 1 cut(s) 95
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
FaiI YATR 6 cut(s) 6, 105, 110, 121, 143, 176
Fnu4HI GCNGC 2 cut(s) 48, 139
FokI GGATG 1 cut(s) 38
Fsp4HI GCNGC 2 cut(s) 48, 139
FspEI CC 9 cut(s) 8, 25, 41, 65, 82, 83, 95, 172, 184
GluI GCNGC 2 cut(s) 48, 139
Hpy188III TCNNGA 2 cut(s) 16, 132
HpyCH4V TGCA 3 cut(s) 50, 87, 141
HpyF3I CTNAG 1 cut(s) 78
Kzo9I GATC 1 cut(s) 95
LpnPI CCDG 3 cut(s) 8, 65, 172
Lsp1109I GCAGC 2 cut(s) 34, 125
LweI GCATC 1 cut(s) 59
MalI GATC 1 cut(s) 97
MboI GATC 1 cut(s) 95
MboII GAAGA 1 cut(s) 41
MfeI CAATTG 1 cut(s) 88
MluCI AATT 3 cut(s) 88, 113, 183
MseI TTAA 1 cut(s) 36
MunI CAATTG 1 cut(s) 88
NdeII GATC 1 cut(s) 95
PkrI GCNGC 2 cut(s) 49, 140
SaqAI TTAA 1 cut(s) 36
SatI GCNGC 2 cut(s) 48, 139
Sau3AI GATC 1 cut(s) 95
SetI ASST 4 cut(s) 24, 49, 84, 140
SfaNI GCATC 1 cut(s) 59
SgeI CNNG 5 cut(s) 28, 35, 92, 144, 171
Sse9I AATT 3 cut(s) 88, 113, 183
TaqI TCGA 1 cut(s) 94
TasI AATT 3 cut(s) 88, 113, 183
Tru1I TTAA 1 cut(s) 36
Tru9I TTAA 1 cut(s) 36
TseI GCWGC 2 cut(s) 47, 138
TspDTI ATGAA 2 cut(s) 42, 92
XapI RAATTY 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.