pycom16g25460

Component of the replication protein A complex (RPA) required for DNA recombination, repair and replication. The activity of RPA is mediated by single-stranded DNA binding and protein interactions. Probably involved in repair of double-strand DNA breaks (DSBs) induced by genotoxic stresses

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
27424705 .. 27425263
559 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 510 bp
ATGGGTAACTTCATTTTCAAGTTGAAAGTAAGGGAGGAGATTTTTAGTGATGAACGTGTAAAATCAATAGTTATCAAAACAGAGAAGCTTAAGATGGAAAATATTAGTTCTTCTGCCTCCAAAAGAGACAATGTAATGCCTACCAGAATTAATGTTGCTAGATTCGGGAACGCTACAAGTAGACAGCCCACAACAGCTGGGAATGTTGGTTACAGTAACAATGCCGGTAGAGAATTTGGAGCACTAGAAAACCAAGCGGGTCACAATGGGAATCAGTATGACAGTAAGTTTCTTTCAAAAGGCTCTGCTAGTTCGTATCAAACATGTAATTGTTATGAGGATACTGGCCATAGCTCAATGAACTGCCCAAGTGTAAAGAATGGCCCGAGACAGTCATTGGGAGTGGGCTATAGCAGTAAAGCGTCTTCTAGGCCAGGTATCATCAATACTTCAATTGAATGGTTCAAATGCCACCACCTGGACATTGGACGAGAAACTATCCTGGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

170

Amino Acids

18.55

Weight (kDa)

9.36

Isoelectric Point (pI)

33.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 478
AccI GTMKAC 1 cut(s) 181
AciI CCGC 1 cut(s) 257
AcoI YGGCCR 1 cut(s) 346
AcsI RAATTY 1 cut(s) 233
AfiI CCNNNNNNNGG 1 cut(s) 478
AflII CTTAAG 1 cut(s) 89
AflIII ACRYGT 2 cut(s) 55, 323
AgsI TTSAA 6 cut(s) 19, 25, 297, 453, 458, 466
AjnI CCWGG 3 cut(s) 433, 477, 501
AluBI AGCT 3 cut(s) 88, 197, 354
AluI AGCT 3 cut(s) 88, 197, 354
Alw21I GWGCWC 1 cut(s) 244
Alw26I GTCTC 2 cut(s) 120, 382
Ama87I CYCGRG 1 cut(s) 385
AoxI GGCC 3 cut(s) 346, 382, 431
ApoI RAATTY 1 cut(s) 233
AseI ATTAAT 1 cut(s) 150
AspS9I GGNCC 1 cut(s) 383
AvaI CYCGRG 1 cut(s) 385
BalI TGGCCA 1 cut(s) 348
BarI GAAGNNNNNNTAC 2 cut(s) 409, 441
BbsI GAAGAC 1 cut(s) 417
Bbv12I GWGCWC 1 cut(s) 244
BccI CCATC 1 cut(s) 88
BciT130I CCWGG 3 cut(s) 435, 479, 503
BciVI GTATCC 1 cut(s) 334
BcoDI GTCTC 2 cut(s) 120, 382
BfaI CTAG 4 cut(s) 159, 245, 309, 429
BfmI CTRYAG 1 cut(s) 409
BfrI CTTAAG 1 cut(s) 89
BfuI GTATCC 1 cut(s) 334
Bme1390I CCNGG 3 cut(s) 435, 479, 503
BmeT110I CYCGRG 1 cut(s) 385
BmgT120I GGNCC 1 cut(s) 383
BmrFI CCNGG 3 cut(s) 435, 479, 503
BpiI GAAGAC 1 cut(s) 417
BsaJI CCNNGG 1 cut(s) 502
Bsc4I CCNNNNNNNGG 1 cut(s) 478
Bse118I RCCGGY 1 cut(s) 224
Bse1I ACTGG 1 cut(s) 349
BseBI CCWGG 3 cut(s) 435, 479, 503
BseDI CCNNGG 1 cut(s) 502
BseLI CCNNNNNNNGG 1 cut(s) 478
BseNI ACTGG 1 cut(s) 349
BseRI GAGGAG 1 cut(s) 50
BseYI CCCAGC 1 cut(s) 197
BshFI GGCC 3 cut(s) 348, 384, 433
BsiHKAI GWGCWC 1 cut(s) 244
BsiHKCI CYCGRG 1 cut(s) 385
BsiSI CCGG 1 cut(s) 225
BslI CCNNNNNNNGG 1 cut(s) 478
BsmAI GTCTC 2 cut(s) 120, 382
BsnI GGCC 3 cut(s) 348, 384, 433
BsoBI CYCGRG 1 cut(s) 385
Bsp1286I GDGCHC 1 cut(s) 244
BspACI CCGC 1 cut(s) 257
BspANI GGCC 3 cut(s) 348, 384, 433
BspTI CTTAAG 1 cut(s) 89
BsrFI RCCGGY 1 cut(s) 224
BsrI ACTGG 1 cut(s) 349
BssAI RCCGGY 1 cut(s) 224
BssECI CCNNGG 1 cut(s) 502
Bst2UI CCWGG 3 cut(s) 435, 479, 503
Bst4CI ACNGT 3 cut(s) 215, 284, 393
BstAFI CTTAAG 1 cut(s) 89
BstMAI GTCTC 2 cut(s) 120, 382
BstNI CCWGG 3 cut(s) 435, 479, 503
BstNSI RCATGY 1 cut(s) 327
BstSCI CCNGG 3 cut(s) 433, 477, 501
BstSFI CTRYAG 1 cut(s) 409
BstV2I GAAGAC 1 cut(s) 417
BsuI GTATCC 1 cut(s) 334
BsuRI GGCC 3 cut(s) 348, 384, 433
Cfr10I RCCGGY 1 cut(s) 224
Cfr13I GGNCC 1 cut(s) 383
CseI GACGC 1 cut(s) 411
CviAII CATG 1 cut(s) 324
CviJI RGCY 9 cut(s) 88, 187, 197, 303, 348, 354, 384, 408, 433
CviKI_1 RGCY 9 cut(s) 88, 187, 197, 303, 348, 354, 384, 408, 433
EaeI YGGCCR 1 cut(s) 346
Eco88I CYCGRG 1 cut(s) 385
EcoRII CCWGG 3 cut(s) 433, 477, 501
FaeI CATG 1 cut(s) 327
FaiI YATR 5 cut(s) 279, 325, 336, 351, 411
FatI CATG 1 cut(s) 323
FauI CCCGC 1 cut(s) 250
FblI GTMKAC 1 cut(s) 181
FspBI CTAG 4 cut(s) 159, 245, 309, 429
GsaI CCCAGC 1 cut(s) 201
HaeIII GGCC 3 cut(s) 348, 384, 433
HapII CCGG 1 cut(s) 225
HgaI GACGC 1 cut(s) 411
Hin1II CATG 1 cut(s) 327
HindIII AAGCTT 1 cut(s) 86
HinfI GANTC 2 cut(s) 162, 271
HpaII CCGG 1 cut(s) 225
Hpy166II GTNNAC 1 cut(s) 182
Hpy188III TCNNGA 1 cut(s) 166
Hpy8I GTNNAC 1 cut(s) 182
HpyCH4III ACNGT 3 cut(s) 215, 284, 393
HpyCH4IV ACGT 1 cut(s) 55
HpySE526I ACGT 1 cut(s) 55
Hsp92II CATG 1 cut(s) 327
LmnI GCTCC 1 cut(s) 239
LpnPI CCDG 9 cut(s) 157, 183, 238, 330, 420, 447, 464, 488, 491
MaeI CTAG 4 cut(s) 159, 245, 309, 429
MaeII ACGT 1 cut(s) 55
MaeIII GTNAC 4 cut(s) 5, 209, 215, 260
MboII GAAGA 2 cut(s) 102, 417
MfeI CAATTG 1 cut(s) 453
MhlI GDGCHC 1 cut(s) 244
MlsI TGGCCA 1 cut(s) 348
MluCI AATT 4 cut(s) 147, 233, 328, 453
MluNI TGGCCA 1 cut(s) 348
MnlI CCTC 3 cut(s) 28, 127, 331
Mox20I TGGCCA 1 cut(s) 348
MscI TGGCCA 1 cut(s) 348
MseI TTAA 3 cut(s) 90, 150, 508
Msp20I TGGCCA 1 cut(s) 348
MspA1I CMGCKG 1 cut(s) 197
MspCI CTTAAG 1 cut(s) 89
MspI CCGG 1 cut(s) 225
MspR9I CCNGG 3 cut(s) 435, 479, 503
MunI CAATTG 1 cut(s) 453
MvaI CCWGG 3 cut(s) 435, 479, 503
NlaIII CATG 1 cut(s) 327
NmuCI GTSAC 1 cut(s) 260
NspI RCATGY 1 cut(s) 327
PciI ACATGT 1 cut(s) 323
PfeI GAWTC 2 cut(s) 162, 271
PflMI CCANNNNNTGG 1 cut(s) 478
PscI ACATGT 1 cut(s) 323
PshBI ATTAAT 1 cut(s) 150
Psp6I CCWGG 3 cut(s) 433, 477, 501
PspFI CCCAGC 1 cut(s) 197
PspGI CCWGG 3 cut(s) 433, 477, 501
PspPI GGNCC 1 cut(s) 383
PvuII CAGCTG 1 cut(s) 197
SaqAI TTAA 3 cut(s) 90, 150, 508
Sau96I GGNCC 1 cut(s) 383
ScrFI CCNGG 3 cut(s) 435, 479, 503
SduI GDGCHC 1 cut(s) 244
SetI ASST 6 cut(s) 58, 90, 199, 356, 439, 480
SfcI CTRYAG 1 cut(s) 409
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
Sse9I AATT 4 cut(s) 147, 233, 328, 453
SsiI CCGC 1 cut(s) 257
SspI AATATT 1 cut(s) 103
SspMI CTAG 4 cut(s) 159, 245, 309, 429
StyD4I CCNGG 3 cut(s) 433, 477, 501
TaaI ACNGT 3 cut(s) 215, 284, 393
TaiI ACGT 1 cut(s) 58
TasI AATT 4 cut(s) 147, 233, 328, 453
TfiI GAWTC 2 cut(s) 162, 271
Tru1I TTAA 3 cut(s) 90, 150, 508
Tru9I TTAA 3 cut(s) 90, 150, 508
TseFI GTSAC 1 cut(s) 260
Tsp45I GTSAC 1 cut(s) 260
TspDTI ATGAA 2 cut(s) 66, 374
Van91I CCANNNNNTGG 1 cut(s) 478
Vha464I CTTAAG 1 cut(s) 89
VspI ATTAAT 1 cut(s) 150
XapI RAATTY 1 cut(s) 233
XceI RCATGY 1 cut(s) 327
XcmI CCANNNNNNNNNTGG 1 cut(s) 482
XmiI GTMKAC 1 cut(s) 181
XspI CTAG 4 cut(s) 159, 245, 309, 429
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.