RchiOBHm_Chr5g0061631

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
67193845 .. 67194982
1138 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 228 bp
ATGGCAACCGCTTCTCTAACACCCCAAAAGAAGAAAACCACTGCCCTTCCACCAACAAAGAGGGGCAAAATCAAGGCTCGGATTCTCAGAGACTTGGTCAAAGCTGTGGTCTCCATGGTCAAACCCGGAGATCAGGGAAAAAAGATAGCCACTGAAGTTGGTGGAGGCTCTGCCTCTCCAACACCACCACTCGGTGGCTACAACTCCTATGGCAGCCCCAATGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

7.72

Weight (kDa)

10.46

Isoelectric Point (pI)

38.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 194
AciI CCGC 1 cut(s) 9
AcuI CTGAAG 1 cut(s) 174
AdeI CACNNNGTG 1 cut(s) 194
AfiI CCNNNNNNNGG 2 cut(s) 191, 194
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
Alw26I GTCTC 2 cut(s) 84, 115
ApeKI GCWGC 1 cut(s) 213
ArsI GACNNNNNNTTYG 2 cut(s) 93, 125
AsuC2I CCSGG 1 cut(s) 126
BcnI CCSGG 1 cut(s) 126
BcoDI GTCTC 2 cut(s) 84, 115
BisI GCNGC 1 cut(s) 214
BlsI GCNGC 1 cut(s) 215
Bme1390I CCNGG 1 cut(s) 126
BmrFI CCNGG 1 cut(s) 126
BpuMI CCSGG 1 cut(s) 126
BsaI GGTCTC 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 114
Bsc4I CCNNNNNNNGG 2 cut(s) 191, 194
BseDI CCNNGG 1 cut(s) 114
BseLI CCNNNNNNNGG 2 cut(s) 191, 194
BseMII CTCAG 1 cut(s) 100
BsiSI CCGG 1 cut(s) 126
BslI CCNNNNNNNGG 2 cut(s) 191, 194
BsmAI GTCTC 2 cut(s) 84, 115
Bso31I GGTCTC 1 cut(s) 115
Bsp143I GATC 1 cut(s) 130
Bsp19I CCATGG 1 cut(s) 114
BspACI CCGC 1 cut(s) 9
BspCNI CTCAG 1 cut(s) 99
BspTNI GGTCTC 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 114
BssMI GATC 1 cut(s) 130
BssT1I CCWWGG 1 cut(s) 114
BstDEI CTNAG 1 cut(s) 86
BstDSI CCRYGG 1 cut(s) 114
BstKTI GATC 1 cut(s) 133
BstMAI GTCTC 2 cut(s) 84, 115
BstMBI GATC 1 cut(s) 130
BstSCI CCNGG 1 cut(s) 124
BtgI CCRYGG 1 cut(s) 114
BtsI GCAGTG 1 cut(s) 39
BtsIMutI CAGTG 2 cut(s) 39, 150
CspCI CAANNNNNGTGG 2 cut(s) 139, 174
CviAII CATG 1 cut(s) 115
CviJI RGCY 6 cut(s) 77, 104, 149, 168, 198, 216
CviKI_1 RGCY 6 cut(s) 77, 104, 149, 168, 198, 216
DdeI CTNAG 1 cut(s) 86
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
DraIII CACNNNGTG 1 cut(s) 194
Eco130I CCWWGG 1 cut(s) 114
Eco31I GGTCTC 1 cut(s) 115
Eco57I CTGAAG 1 cut(s) 174
EcoT14I CCWWGG 1 cut(s) 114
ErhI CCWWGG 1 cut(s) 114
FaeI CATG 1 cut(s) 118
FaiI YATR 2 cut(s) 116, 210
FatI CATG 1 cut(s) 114
Fnu4HI GCNGC 1 cut(s) 214
Fsp4HI GCNGC 1 cut(s) 214
GluI GCNGC 1 cut(s) 214
HapII CCGG 1 cut(s) 126
Hin1II CATG 1 cut(s) 118
HinfI GANTC 1 cut(s) 82
HpaII CCGG 1 cut(s) 126
Hpy188I TCNGA 2 cut(s) 81, 89
HpyAV CCTTC 1 cut(s) 56
HpyF3I CTNAG 1 cut(s) 86
Hsp92II CATG 1 cut(s) 118
Kzo9I GATC 1 cut(s) 130
LpnPI CCDG 2 cut(s) 119, 139
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MboII GAAGA 1 cut(s) 43
MmeI TCCRAC 1 cut(s) 203
MnlI CCTC 3 cut(s) 54, 158, 184
MspI CCGG 1 cut(s) 126
MspR9I CCNGG 1 cut(s) 126
NciI CCSGG 1 cut(s) 126
NcoI CCATGG 1 cut(s) 114
NdeII GATC 1 cut(s) 130
NlaIII CATG 1 cut(s) 118
PfeI GAWTC 1 cut(s) 82
PflFI GACNNNGTC 1 cut(s) 95
PflMI CCANNNNNTGG 1 cut(s) 194
PkrI GCNGC 1 cut(s) 215
PsyI GACNNNGTC 1 cut(s) 95
SatI GCNGC 1 cut(s) 214
Sau3AI GATC 1 cut(s) 130
ScrFI CCNGG 1 cut(s) 126
SetI ASST 1 cut(s) 106
SgeI CNNG 8 cut(s) 85, 90, 106, 127, 137, 138, 146, 203
SsiI CCGC 1 cut(s) 9
StyD4I CCNGG 1 cut(s) 124
StyI CCWWGG 1 cut(s) 114
TfiI GAWTC 1 cut(s) 82
TscAI CASTG 2 cut(s) 46, 157
TseI GCWGC 1 cut(s) 213
TspRI CASTG 2 cut(s) 46, 157
Tth111I GACNNNGTC 1 cut(s) 95
Van91I CCANNNNNTGG 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.