RchiOBHm_Chr5g0061721

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
67306161 .. 67306800
640 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGGAAAACCCAAACACCATATCCAAAAACCACAAGCGAAGCCTCTACCTTCCCAGGAGAGGGCAGGTCAAGATCAAGATATTCAAGTGCTTGTTCAAGTCGTTGGCTTCGATGTTGGGTGCGTTTGCCCGGAAGCCAGACGGAGAAGATGGAGGGTTCTTGAGCTCCAATTCCCAAACTCCGGCTGAAACCCCAAGTGGGTATTGCTCCGATGCTCAATCTGATCGTTCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.47

Weight (kDa)

9.56

Isoelectric Point (pI)

42.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 55
AfiI CCNNNNNNNGG 4 cut(s) 59, 60, 181, 198
AgsI TTSAA 2 cut(s) 85, 97
AjnI CCWGG 1 cut(s) 53
AluBI AGCT 1 cut(s) 165
AluI AGCT 1 cut(s) 165
Alw21I GWGCWC 1 cut(s) 167
AsuC2I CCSGG 1 cut(s) 130
BanII GRGCYC 1 cut(s) 167
Bbv12I GWGCWC 1 cut(s) 167
BccI CCATC 1 cut(s) 143
BciT130I CCWGG 1 cut(s) 55
BcnI CCSGG 1 cut(s) 130
BfuAI ACCTGC 1 cut(s) 55
Bme1390I CCNGG 2 cut(s) 55, 130
BmrFI CCNGG 2 cut(s) 55, 130
BmsI GCATC 1 cut(s) 202
BpuEI CTTGAG 1 cut(s) 181
BpuMI CCSGG 1 cut(s) 130
BsaJI CCNNGG 1 cut(s) 53
Bsc4I CCNNNNNNNGG 4 cut(s) 59, 60, 181, 198
BseBI CCWGG 1 cut(s) 55
BseDI CCNNGG 1 cut(s) 53
BseLI CCNNNNNNNGG 4 cut(s) 59, 60, 181, 198
BsiHKAI GWGCWC 1 cut(s) 167
BsiSI CCGG 2 cut(s) 130, 182
BslI CCNNNNNNNGG 4 cut(s) 59, 60, 181, 198
Bsp1286I GDGCHC 1 cut(s) 167
Bsp143I GATC 2 cut(s) 72, 223
BspMI ACCTGC 1 cut(s) 55
BssECI CCNNGG 1 cut(s) 53
BssMI GATC 2 cut(s) 72, 223
Bst2UI CCWGG 1 cut(s) 55
BstKTI GATC 2 cut(s) 75, 226
BstMBI GATC 2 cut(s) 72, 223
BstNI CCWGG 1 cut(s) 55
BstSCI CCNGG 2 cut(s) 53, 128
BveI ACCTGC 1 cut(s) 55
CviJI RGCY 5 cut(s) 42, 107, 136, 165, 185
CviKI_1 RGCY 5 cut(s) 42, 107, 136, 165, 185
DpnI GATC 2 cut(s) 74, 225
DpnII GATC 2 cut(s) 72, 223
Ecl136II GAGCTC 1 cut(s) 165
Eco24I GRGCYC 1 cut(s) 167
Eco53kI GAGCTC 1 cut(s) 165
EcoICRI GAGCTC 1 cut(s) 165
EcoRII CCWGG 1 cut(s) 53
EcoT38I GRGCYC 1 cut(s) 167
FaiI YATR 1 cut(s) 20
FriOI GRGCYC 1 cut(s) 167
HapII CCGG 2 cut(s) 130, 182
HpaII CCGG 2 cut(s) 130, 182
Hpy188I TCNGA 2 cut(s) 211, 223
Hpy188III TCNNGA 4 cut(s) 70, 76, 160, 231
HpyAV CCTTC 1 cut(s) 59
Kzo9I GATC 2 cut(s) 72, 223
LmnI GCTCC 2 cut(s) 170, 212
LpnPI CCDG 6 cut(s) 40, 50, 67, 143, 150, 195
LweI GCATC 1 cut(s) 202
MalI GATC 2 cut(s) 74, 225
MboI GATC 2 cut(s) 72, 223
MboII GAAGA 1 cut(s) 158
MhlI GDGCHC 1 cut(s) 167
MluCI AATT 1 cut(s) 169
MnlI CCTC 3 cut(s) 53, 53, 146
MspI CCGG 2 cut(s) 130, 182
MspR9I CCNGG 2 cut(s) 55, 130
MvaI CCWGG 1 cut(s) 55
NciI CCSGG 1 cut(s) 130
NdeII GATC 2 cut(s) 72, 223
PcsI WCGNNNNNNNCGW 1 cut(s) 107
Psp124BI GAGCTC 1 cut(s) 167
Psp6I CCWGG 1 cut(s) 53
PspGI CCWGG 1 cut(s) 53
SacI GAGCTC 1 cut(s) 167
Sau3AI GATC 2 cut(s) 72, 223
ScrFI CCNGG 2 cut(s) 55, 130
SduI GDGCHC 1 cut(s) 167
SetI ASST 3 cut(s) 51, 69, 167
SfaNI GCATC 1 cut(s) 202
SmlI CTYRAG 1 cut(s) 160
SmoI CTYRAG 1 cut(s) 160
Sse9I AATT 1 cut(s) 169
SstI GAGCTC 1 cut(s) 167
StyD4I CCNGG 2 cut(s) 53, 128
TaqI TCGA 1 cut(s) 110
TasI AATT 1 cut(s) 169
TspGWI ACGGA 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.