RchiOBHm_Chr3g0449261

acyl-activating enzyme

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
1128110 .. 1128364
255 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 255 bp
ATGCATGAACTCTATTTTGCAGCTCCAATGGCTAGGGCAGTTCTTTATACACTTAATGCACGCCTTGATTCAGCTATGATATATGTTCTTCTTAGTCATTTTGAAGCTAAAATCATCTTTGTCGATCACCAATTACTTGGAATTGTTGATGGAGCACTTGAATTACTTGCCAAAAAAGCTGATTCAAAACTACCGGTTGTAGTGATGATCAGTCATCTACCAGCTTTACTTCAAAAAAACAAACCCAAATTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.37

Weight (kDa)

9.05

Isoelectric Point (pI)

26.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgeI ACCGGT 1 cut(s) 193
AgsI TTSAA 4 cut(s) 104, 161, 186, 233
AluBI AGCT 5 cut(s) 23, 74, 107, 179, 224
AluI AGCT 5 cut(s) 23, 74, 107, 179, 224
Alw21I GWGCWC 1 cut(s) 157
ApeKI GCWGC 1 cut(s) 20
AsiGI ACCGGT 1 cut(s) 193
AsuHPI GGTGA 1 cut(s) 119
Bbv12I GWGCWC 1 cut(s) 157
BbvI GCAGC 1 cut(s) 32
BccI CCATC 1 cut(s) 143
BclI TGATCA 1 cut(s) 207
BfaI CTAG 1 cut(s) 33
BisI GCNGC 1 cut(s) 21
BlsI GCNGC 1 cut(s) 22
BsaWI WCCGGW 1 cut(s) 193
Bse118I RCCGGY 1 cut(s) 193
BseXI GCAGC 1 cut(s) 32
BshTI ACCGGT 1 cut(s) 193
BsiHKAI GWGCWC 1 cut(s) 157
BsiSI CCGG 1 cut(s) 194
Bsp1286I GDGCHC 1 cut(s) 157
Bsp143I GATC 2 cut(s) 124, 207
BsrFI RCCGGY 1 cut(s) 193
BssAI RCCGGY 1 cut(s) 193
BssMI GATC 2 cut(s) 124, 207
BstC8I GCNNGC 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 92
BstKTI GATC 2 cut(s) 127, 210
BstMBI GATC 2 cut(s) 124, 207
BstMWI GCNNNNNNNGC 2 cut(s) 29, 176
BstV1I GCAGC 1 cut(s) 32
BstXI CCANNNNNNTGG 1 cut(s) 137
Cac8I GCNNGC 1 cut(s) 61
Cfr10I RCCGGY 1 cut(s) 193
CspAI ACCGGT 1 cut(s) 193
CviAII CATG 1 cut(s) 5
CviJI RGCY 6 cut(s) 23, 32, 74, 107, 179, 224
CviKI_1 RGCY 6 cut(s) 23, 32, 74, 107, 179, 224
DdeI CTNAG 1 cut(s) 92
DpnI GATC 2 cut(s) 126, 209
DpnII GATC 2 cut(s) 124, 207
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 8
FaiI YATR 6 cut(s) 6, 48, 77, 82, 84, 253
FatI CATG 1 cut(s) 4
FbaI TGATCA 1 cut(s) 207
Fnu4HI GCNGC 1 cut(s) 21
Fsp4HI GCNGC 1 cut(s) 21
FspBI CTAG 1 cut(s) 33
GluI GCNGC 1 cut(s) 21
HapII CCGG 1 cut(s) 194
Hin1II CATG 1 cut(s) 8
HinfI GANTC 2 cut(s) 68, 182
HpaII CCGG 1 cut(s) 194
HphI GGTGA 1 cut(s) 119
HpyCH4V TGCA 3 cut(s) 4, 20, 59
HpyF10VI GCNNNNNNNGC 2 cut(s) 29, 176
HpyF3I CTNAG 1 cut(s) 92
Hsp92II CATG 1 cut(s) 8
Ksp22I TGATCA 1 cut(s) 207
Kzo9I GATC 2 cut(s) 124, 207
LmnI GCTCC 2 cut(s) 28, 152
LpnPI CCDG 2 cut(s) 207, 234
Lsp1109I GCAGC 1 cut(s) 32
MaeI CTAG 1 cut(s) 33
MalI GATC 2 cut(s) 126, 209
MboI GATC 2 cut(s) 124, 207
MboII GAAGA 1 cut(s) 80
MhlI GDGCHC 1 cut(s) 157
MluCI AATT 4 cut(s) 131, 141, 161, 248
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 54
MspI CCGG 1 cut(s) 194
MwoI GCNNNNNNNGC 2 cut(s) 29, 176
NdeII GATC 2 cut(s) 124, 207
NlaIII CATG 1 cut(s) 8
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 2 cut(s) 68, 182
PinAI ACCGGT 1 cut(s) 193
PkrI GCNGC 1 cut(s) 22
SaqAI TTAA 1 cut(s) 54
SatI GCNGC 1 cut(s) 21
Sau3AI GATC 2 cut(s) 124, 207
SduI GDGCHC 1 cut(s) 157
SetI ASST 5 cut(s) 25, 76, 109, 181, 226
SgeI CNNG 9 cut(s) 17, 45, 72, 77, 149, 170, 179, 206, 233
Sse9I AATT 4 cut(s) 131, 141, 161, 248
SspMI CTAG 1 cut(s) 33
TaqI TCGA 1 cut(s) 123
TasI AATT 4 cut(s) 131, 141, 161, 248
TfiI GAWTC 2 cut(s) 68, 182
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TseI GCWGC 1 cut(s) 20
TspDTI ATGAA 1 cut(s) 21
XspI CTAG 1 cut(s) 33
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.