Rmu_sc0004874.1_g000003

acyl-activating enzyme

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004874.1
OG0001719
Physical Location & Seq
Reverse (-)
8719 .. 9084
366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004874.1_g000003.1.cds

Sequence Viewer

Length: 366 bp
atgcctgtttatctatggaatgtgcctatgtttcattgcaatggacggtgcctcatttggggtttggttgctcagggtggtactaacatttgcctaagaaaagtcactccaaaaggcatatatgacaacattgctctacacaatgtaacacacatgggaggggcaccaactgtgctgaacatgattgttaattcaccagagagtgacctaagaccacttcctcacaaggtggaagtaatgacaggtggctccccacccccaccacagatcctgttcaatatggaagagatgggttttagggtgattcacttgtatggtctcacagagacttatggtccagggacctacatgctcatggaaacctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AMP-binding AMP-binding_C

Protein Analysis

121

Amino Acids

13.44

Weight (kDa)

6.49

Isoelectric Point (pI)

60.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 48, 163
AclWI GGATC 1 cut(s) 262
AdeI CACNNNGTG 1 cut(s) 229
AfaI GTAC 1 cut(s) 82
AfiI CCNNNNNNNGG 1 cut(s) 58
AgsI TTSAA 1 cut(s) 277
AhdI GACNNNNNGTC 1 cut(s) 333
AjnI CCWGG 1 cut(s) 337
Alw26I GTCTC 2 cut(s) 320, 323
AlwI GGATC 1 cut(s) 262
AlwNI CAGNNNCTG 1 cut(s) 271
AspS9I GGNCC 2 cut(s) 335, 342
AsuHPI GGTGA 2 cut(s) 186, 313
AvaII GGWCC 2 cut(s) 335, 342
BaeGI GKGCMC 1 cut(s) 166
BanI GGYRCC 2 cut(s) 48, 163
BccI CCATC 1 cut(s) 283
BciT130I CCWGG 1 cut(s) 339
BcoDI GTCTC 2 cut(s) 320, 323
Bme1390I CCNGG 1 cut(s) 339
Bme18I GGWCC 2 cut(s) 335, 342
BmeRI GACNNNNNGTC 1 cut(s) 333
BmgT120I GGNCC 2 cut(s) 335, 342
BmiI GGNNCC 4 cut(s) 50, 165, 250, 343
BmrFI CCNGG 1 cut(s) 339
Bpu10I CCTNAGC 1 cut(s) 72
BsaI GGTCTC 1 cut(s) 323
BsaJI CCNNGG 1 cut(s) 338
Bsc4I CCNNNNNNNGG 1 cut(s) 58
Bse3DI GCAATG 3 cut(s) 34, 46, 129
BseBI CCWGG 1 cut(s) 339
BseDI CCNNGG 1 cut(s) 338
BseLI CCNNNNNNNGG 1 cut(s) 58
BseMI GCAATG 3 cut(s) 34, 46, 129
BseMII CTCAG 1 cut(s) 86
BseSI GKGCMC 1 cut(s) 166
BshNI GGYRCC 2 cut(s) 48, 163
BslFI GGGAC 1 cut(s) 355
BslI CCNNNNNNNGG 1 cut(s) 58
BsmAI GTCTC 2 cut(s) 320, 323
BsmFI GGGAC 1 cut(s) 355
Bso31I GGTCTC 1 cut(s) 323
Bsp1286I GDGCHC 1 cut(s) 166
Bsp143I GATC 1 cut(s) 267
BspCNI CTCAG 1 cut(s) 85
BspLI GGNNCC 4 cut(s) 50, 165, 250, 343
BspPI GGATC 1 cut(s) 262
BspT107I GGYRCC 2 cut(s) 48, 163
BspTNI GGTCTC 1 cut(s) 323
BsrDI GCAATG 3 cut(s) 34, 46, 129
BssECI CCNNGG 1 cut(s) 338
BssMI GATC 1 cut(s) 267
Bst2UI CCWGG 1 cut(s) 339
Bst4CI ACNGT 2 cut(s) 48, 172
Bst6I CTCTTC 1 cut(s) 279
BstDEI CTNAG 3 cut(s) 72, 95, 209
BstKTI GATC 1 cut(s) 270
BstMAI GTCTC 2 cut(s) 320, 323
BstMBI GATC 1 cut(s) 267
BstNI CCWGG 1 cut(s) 339
BstNSI RCATGY 1 cut(s) 352
BstSCI CCNGG 1 cut(s) 337
BstSLI GKGCMC 1 cut(s) 166
BstX2I RGATCY 1 cut(s) 267
BstYI RGATCY 1 cut(s) 267
CaiI CAGNNNCTG 1 cut(s) 271
Cfr13I GGNCC 2 cut(s) 335, 342
Csp6I GTAC 1 cut(s) 81
CviAII CATG 4 cut(s) 154, 181, 349, 355
CviJI RGCY 1 cut(s) 249
CviKI_1 RGCY 1 cut(s) 249
CviQI GTAC 1 cut(s) 81
DdeI CTNAG 3 cut(s) 72, 95, 209
DpnI GATC 1 cut(s) 269
DpnII GATC 1 cut(s) 267
DraIII CACNNNGTG 1 cut(s) 229
DriI GACNNNNNGTC 1 cut(s) 333
Eam1104I CTCTTC 1 cut(s) 279
Eam1105I GACNNNNNGTC 1 cut(s) 333
EarI CTCTTC 1 cut(s) 279
Eco31I GGTCTC 1 cut(s) 323
Eco47I GGWCC 2 cut(s) 335, 342
EcoO109I RGGNCCY 1 cut(s) 342
EcoRII CCWGG 1 cut(s) 337
FaeI CATG 4 cut(s) 157, 184, 352, 358
FaqI GGGAC 1 cut(s) 355
FatI CATG 4 cut(s) 153, 180, 348, 354
Hin1II CATG 4 cut(s) 157, 184, 352, 358
HinfI GANTC 1 cut(s) 304
HphI GGTGA 2 cut(s) 186, 313
HpyCH4III ACNGT 2 cut(s) 48, 172
HpyCH4V TGCA 1 cut(s) 39
HpyF3I CTNAG 3 cut(s) 72, 95, 209
Hsp92II CATG 4 cut(s) 157, 184, 352, 358
Kzo9I GATC 1 cut(s) 267
LmnI GCTCC 1 cut(s) 254
LpnPI CCDG 7 cut(s) 18, 59, 210, 228, 284, 324, 351
MaeIII GTNAC 3 cut(s) 103, 145, 203
MalI GATC 1 cut(s) 269
MboI GATC 1 cut(s) 267
MboII GAAGA 1 cut(s) 296
MflI RGATCY 1 cut(s) 267
MhlI GDGCHC 1 cut(s) 166
MluCI AATT 1 cut(s) 190
MnlI CCTC 3 cut(s) 62, 152, 231
MseI TTAA 1 cut(s) 189
MslI CAYNNNNRTG 3 cut(s) 39, 312, 353
MspR9I CCNGG 1 cut(s) 339
MvaI CCWGG 1 cut(s) 339
NdeII GATC 1 cut(s) 267
NlaIII CATG 4 cut(s) 157, 184, 352, 358
NlaIV GGNNCC 4 cut(s) 50, 165, 250, 343
NmuCI GTSAC 2 cut(s) 103, 203
NspI RCATGY 1 cut(s) 352
PfeI GAWTC 1 cut(s) 304
PpuMI RGGWCCY 1 cut(s) 342
Psp5II RGGWCCY 1 cut(s) 342
Psp6I CCWGG 1 cut(s) 337
PspGI CCWGG 1 cut(s) 337
PspN4I GGNNCC 4 cut(s) 50, 165, 250, 343
PspPI GGNCC 2 cut(s) 335, 342
PspPPI RGGWCCY 1 cut(s) 342
PstNI CAGNNNCTG 1 cut(s) 271
PsuI RGATCY 1 cut(s) 267
RsaI GTAC 1 cut(s) 82
RsaNI GTAC 1 cut(s) 81
RseI CAYNNNNRTG 3 cut(s) 39, 312, 353
SaqAI TTAA 1 cut(s) 189
Sau3AI GATC 1 cut(s) 267
Sau96I GGNCC 2 cut(s) 335, 342
ScrFI CCNGG 1 cut(s) 339
SduI GDGCHC 1 cut(s) 166
SetI ASST 5 cut(s) 210, 231, 247, 347, 365
SinI GGWCC 2 cut(s) 335, 342
SmiMI CAYNNNNRTG 3 cut(s) 39, 312, 353
Sse9I AATT 1 cut(s) 190
StyD4I CCNGG 1 cut(s) 337
TaaI ACNGT 2 cut(s) 48, 172
TasI AATT 1 cut(s) 190
TfiI GAWTC 1 cut(s) 304
Tru1I TTAA 1 cut(s) 189
Tru9I TTAA 1 cut(s) 189
TseFI GTSAC 2 cut(s) 103, 203
Tsp45I GTSAC 2 cut(s) 103, 203
TspDTI ATGAA 1 cut(s) 23
VpaK11BI GGWCC 2 cut(s) 335, 342
XceI RCATGY 1 cut(s) 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.