RchiOBHm_Chr3g0465611

Cell cycle regulated microtubule associated protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
12345056 .. 12348363
3308 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGGAATCTGACTTCGGTTCAGGTGGTGATGATGACGGGTTTTACATGTTGATTGTGTTTTCCACAGAGATTAAAGGACCAAACTCCGCCTCTGCTAAAAGTGATAAATGCAAAGTACTCTCTCTTAAAAAGAAGCCATTATCAAGTAAAGAAGGACCTGGTGTTATCCCAAGTGTCAGACAGGAAAGCAGACGACCAAGTCCACGGGAATTAAAGTCTGTCAGAGGTTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.31

Weight (kDa)

9.46

Isoelectric Point (pI)

49.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 198
AciI CCGC 1 cut(s) 87
AfaI GTAC 1 cut(s) 117
AflIII ACRYGT 1 cut(s) 45
AjnI CCWGG 1 cut(s) 157
AspS9I GGNCC 2 cut(s) 77, 155
AsuHPI GGTGA 1 cut(s) 38
AvaII GGWCC 2 cut(s) 77, 155
BciT130I CCWGG 1 cut(s) 159
BmcAI AGTACT 1 cut(s) 117
Bme1390I CCNGG 1 cut(s) 159
Bme18I GGWCC 2 cut(s) 77, 155
BmgT120I GGNCC 2 cut(s) 77, 155
BmrFI CCNGG 1 cut(s) 159
BsaJI CCNNGG 1 cut(s) 203
BseBI CCWGG 1 cut(s) 159
BseDI CCNNGG 1 cut(s) 203
BspACI CCGC 1 cut(s) 87
BssECI CCNNGG 1 cut(s) 203
Bst2UI CCWGG 1 cut(s) 159
BstDSI CCRYGG 1 cut(s) 203
BstNI CCWGG 1 cut(s) 159
BstNSI RCATGY 1 cut(s) 49
BstSCI CCNGG 1 cut(s) 157
BtgI CCRYGG 1 cut(s) 203
Cfr13I GGNCC 2 cut(s) 77, 155
CsiI ACCWGGT 1 cut(s) 157
Csp6I GTAC 1 cut(s) 116
CviAII CATG 1 cut(s) 46
CviJI RGCY 1 cut(s) 136
CviKI_1 RGCY 1 cut(s) 136
CviQI GTAC 1 cut(s) 116
DrdI GACNNNNNNGTC 1 cut(s) 198
DseDI GACNNNNNNGTC 1 cut(s) 198
EciI GGCGGA 1 cut(s) 76
Eco47I GGWCC 2 cut(s) 77, 155
EcoO109I RGGNCCY 1 cut(s) 155
EcoRII CCWGG 1 cut(s) 157
FaeI CATG 1 cut(s) 49
FaiI YATR 2 cut(s) 47, 232
FatI CATG 1 cut(s) 45
Hin1II CATG 1 cut(s) 49
HinfI GANTC 1 cut(s) 5
HphI GGTGA 1 cut(s) 38
Hpy166II GTNNAC 1 cut(s) 203
Hpy188I TCNGA 3 cut(s) 10, 179, 224
Hpy8I GTNNAC 1 cut(s) 203
HpyAV CCTTC 1 cut(s) 146
HpyCH4V TGCA 1 cut(s) 111
Hsp92II CATG 1 cut(s) 49
LpnPI CCDG 4 cut(s) 6, 144, 167, 171
MabI ACCWGGT 1 cut(s) 157
MluCI AATT 1 cut(s) 209
MnlI CCTC 2 cut(s) 100, 218
MseI TTAA 3 cut(s) 72, 126, 212
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
NlaIII CATG 1 cut(s) 49
NspI RCATGY 1 cut(s) 49
PciI ACATGT 1 cut(s) 45
PfeI GAWTC 1 cut(s) 5
PflFI GACNNNGTC 1 cut(s) 198
PpuMI RGGWCCY 1 cut(s) 155
PscI ACATGT 1 cut(s) 45
Psp5II RGGWCCY 1 cut(s) 155
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
PspPI GGNCC 2 cut(s) 77, 155
PspPPI RGGWCCY 1 cut(s) 155
PsyI GACNNNGTC 1 cut(s) 198
RsaI GTAC 1 cut(s) 117
RsaNI GTAC 1 cut(s) 116
SaqAI TTAA 3 cut(s) 72, 126, 212
Sau96I GGNCC 2 cut(s) 77, 155
ScaI AGTACT 1 cut(s) 117
ScrFI CCNGG 1 cut(s) 159
SetI ASST 3 cut(s) 25, 160, 229
SexAI ACCWGGT 1 cut(s) 157
SinI GGWCC 2 cut(s) 77, 155
Sse9I AATT 1 cut(s) 209
SsiI CCGC 1 cut(s) 87
StyD4I CCNGG 1 cut(s) 157
TasI AATT 1 cut(s) 209
TatI WGTACW 1 cut(s) 115
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 3 cut(s) 72, 126, 212
Tru9I TTAA 3 cut(s) 72, 126, 212
Tth111I GACNNNGTC 1 cut(s) 198
VpaK11BI GGWCC 2 cut(s) 77, 155
XceI RCATGY 1 cut(s) 49
ZrmI AGTACT 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.