Rmu_sc0000554.1_g000033

Cell cycle regulated microtubule associated protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000554.1
Physical Location & Seq
Forward (+)
149504 .. 151512
2009 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000554.1_g000033.1.cds

Sequence Viewer

Length: 570 bp
atggacgacgaagaaatgatggagtttgttaaggaggctttcgagggtgaagaaattgacatggattatgagttcgacgcgcctaggttctatgattttacaacgcttgaaaccgattgggaggctgaagtggctgaagattggttcagatacgccggaagttatccttcgtctcgtaagcaatttacagagctcgttaaatatttgatcacatttctagaaatggaattggatgattttgaatcactagcaatatcctattgtctgcttgagaagaagctagggaaagtcgcggagaattcaccgagttctccattattcgatagtgtagcaactaaaagacagaagttggaggctggctatgtgcggaaggttggaactgctgtaacgtcaccaaatggtagacctaaagtcaccattcctagagaaccaaacttggaaacagcacaaagggcacaaagacgtaggtataagactattgcgaaagatggagaacaagcaaaagtaagtgtctattcccttaacgctcctttagcagaaacgtttgtgcttcaagtcaatagtatttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

189

Amino Acids

21.73

Weight (kDa)

4.67

Isoelectric Point (pI)

44.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 403
AccII CGCG 2 cut(s) 80, 293
AciI CCGC 2 cut(s) 293, 367
AclI AACGTT 1 cut(s) 542
AcsI RAATTY 1 cut(s) 298
AcuI CTGAAG 2 cut(s) 147, 156
AgsI TTSAA 3 cut(s) 110, 242, 554
AhdI GACNNNNNGTC 1 cut(s) 410
AloI GAACNNNNNNTCC 2 cut(s) 56, 88
AluBI AGCT 2 cut(s) 193, 280
AluI AGCT 2 cut(s) 193, 280
Alw21I GWGCWC 1 cut(s) 195
Alw26I GTCTC 1 cut(s) 177
ApoI RAATTY 1 cut(s) 298
AspA2I CCTAGG 1 cut(s) 83
AspLEI GCGC 1 cut(s) 82
AsuHPI GGTGA 4 cut(s) 59, 294, 384, 406
AvrII CCTAGG 1 cut(s) 83
BaeGI GKGCMC 1 cut(s) 457
BanII GRGCYC 1 cut(s) 195
Bbv12I GWGCWC 1 cut(s) 195
BccI CCATC 2 cut(s) 13, 482
BclI TGATCA 1 cut(s) 207
BcoDI GTCTC 1 cut(s) 177
BfaI CTAG 5 cut(s) 84, 218, 248, 281, 423
BlnI CCTAGG 1 cut(s) 83
BmeRI GACNNNNNGTC 1 cut(s) 410
BpuEI CTTGAG 1 cut(s) 290
BsaJI CCNNGG 1 cut(s) 83
BseDI CCNNGG 1 cut(s) 83
BseGI GGATG 1 cut(s) 238
BseSI GKGCMC 1 cut(s) 457
Bsh1236I CGCG 2 cut(s) 80, 293
BsiHKAI GWGCWC 1 cut(s) 195
BsiSI CCGG 1 cut(s) 156
BsmAI GTCTC 1 cut(s) 177
BsmBI CGTCTC 1 cut(s) 177
Bsp1286I GDGCHC 2 cut(s) 195, 457
Bsp143I GATC 1 cut(s) 207
BspACI CCGC 2 cut(s) 293, 367
BspFNI CGCG 2 cut(s) 80, 293
BssECI CCNNGG 1 cut(s) 83
BssMI GATC 1 cut(s) 207
BssT1I CCWWGG 1 cut(s) 83
BstC8I GCNNGC 1 cut(s) 358
BstF5I GGATG 1 cut(s) 238
BstFNI CGCG 2 cut(s) 80, 293
BstHHI GCGC 1 cut(s) 82
BstKTI GATC 1 cut(s) 210
BstMAI GTCTC 1 cut(s) 177
BstMBI GATC 1 cut(s) 207
BstMWI GCNNNNNNNGC 3 cut(s) 131, 452, 533
BstSLI GKGCMC 1 cut(s) 457
BstUI CGCG 2 cut(s) 80, 293
BtsCI GGATG 1 cut(s) 238
Cac8I GCNNGC 1 cut(s) 358
CfoI GCGC 1 cut(s) 82
CseI GACGC 1 cut(s) 86
CviAII CATG 1 cut(s) 61
CviJI RGCY 7 cut(s) 38, 125, 134, 193, 280, 356, 360
CviKI_1 RGCY 7 cut(s) 38, 125, 134, 193, 280, 356, 360
DpnI GATC 1 cut(s) 209
DpnII GATC 1 cut(s) 207
DriI GACNNNNNGTC 1 cut(s) 410
Eam1105I GACNNNNNGTC 1 cut(s) 410
Ecl136II GAGCTC 1 cut(s) 193
Eco130I CCWWGG 1 cut(s) 83
Eco24I GRGCYC 1 cut(s) 195
Eco53kI GAGCTC 1 cut(s) 193
Eco57I CTGAAG 2 cut(s) 147, 156
EcoICRI GAGCTC 1 cut(s) 193
EcoRI GAATTC 1 cut(s) 298
EcoT14I CCWWGG 1 cut(s) 83
EcoT38I GRGCYC 1 cut(s) 195
ErhI CCWWGG 1 cut(s) 83
Esp3I CGTCTC 1 cut(s) 177
FaeI CATG 1 cut(s) 64
FaiI YATR 5 cut(s) 62, 69, 93, 363, 471
FalI AAGNNNNNCTT 2 cut(s) 151, 183
FatI CATG 1 cut(s) 60
FbaI TGATCA 1 cut(s) 207
FblI GTMKAC 1 cut(s) 403
FokI GGATG 1 cut(s) 245
FriOI GRGCYC 1 cut(s) 195
FspBI CTAG 5 cut(s) 84, 218, 248, 281, 423
GlaI GCGC 1 cut(s) 81
HapII CCGG 1 cut(s) 156
HgaI GACGC 1 cut(s) 86
HhaI GCGC 1 cut(s) 82
Hin1II CATG 1 cut(s) 64
Hin6I GCGC 1 cut(s) 80
HinP1I GCGC 1 cut(s) 80
HinfI GANTC 1 cut(s) 242
HpaII CCGG 1 cut(s) 156
HphI GGTGA 4 cut(s) 59, 294, 384, 406
Hpy166II GTNNAC 1 cut(s) 404
Hpy188I TCNGA 1 cut(s) 149
Hpy188III TCNNGA 1 cut(s) 218
Hpy8I GTNNAC 1 cut(s) 404
Hpy99I CGWCG 2 cut(s) 11, 80
HpyAV CCTTC 2 cut(s) 177, 364
HpyCH4IV ACGT 3 cut(s) 389, 463, 542
HpyF10VI GCNNNNNNNGC 3 cut(s) 131, 452, 533
HpySE526I ACGT 3 cut(s) 389, 463, 542
Hsp92II CATG 1 cut(s) 64
HspAI GCGC 1 cut(s) 80
Ksp22I TGATCA 1 cut(s) 207
Kzo9I GATC 1 cut(s) 207
LmnI GCTCC 1 cut(s) 532
LpnPI CCDG 2 cut(s) 169, 342
MaeI CTAG 5 cut(s) 84, 218, 248, 281, 423
MaeII ACGT 3 cut(s) 389, 463, 542
MaeIII GTNAC 3 cut(s) 385, 390, 412
MalI GATC 1 cut(s) 209
MboI GATC 1 cut(s) 207
MboII GAAGA 4 cut(s) 23, 62, 149, 286
MhlI GDGCHC 2 cut(s) 195, 457
MluCI AATT 4 cut(s) 54, 182, 227, 298
MmeI TCCRAC 2 cut(s) 330, 355
MnlI CCTC 4 cut(s) 28, 37, 115, 346
MseI TTAA 3 cut(s) 30, 198, 522
MspI CCGG 1 cut(s) 156
MvnI CGCG 2 cut(s) 80, 293
MwoI GCNNNNNNNGC 3 cut(s) 131, 452, 533
NdeII GATC 1 cut(s) 207
NlaIII CATG 1 cut(s) 64
NmuCI GTSAC 2 cut(s) 390, 412
PfeI GAWTC 1 cut(s) 242
Psp124BI GAGCTC 1 cut(s) 195
Psp1406I AACGTT 1 cut(s) 542
SacI GAGCTC 1 cut(s) 195
SaqAI TTAA 3 cut(s) 30, 198, 522
Sau3AI GATC 1 cut(s) 207
SduI GDGCHC 2 cut(s) 195, 457
SetI ASST 9 cut(s) 89, 195, 282, 375, 392, 409, 466, 470, 545
SmlI CTYRAG 1 cut(s) 269
SmoI CTYRAG 1 cut(s) 269
Sse9I AATT 4 cut(s) 54, 182, 227, 298
SsiI CCGC 2 cut(s) 293, 367
SspI AATATT 1 cut(s) 203
SspMI CTAG 5 cut(s) 84, 218, 248, 281, 423
SstI GAGCTC 1 cut(s) 195
StyI CCWWGG 1 cut(s) 83
TaiI ACGT 3 cut(s) 392, 466, 545
TaqI TCGA 3 cut(s) 42, 75, 321
TasI AATT 4 cut(s) 54, 182, 227, 298
TfiI GAWTC 1 cut(s) 242
Tru1I TTAA 3 cut(s) 30, 198, 522
Tru9I TTAA 3 cut(s) 30, 198, 522
TseFI GTSAC 2 cut(s) 390, 412
Tsp45I GTSAC 2 cut(s) 390, 412
XapI RAATTY 1 cut(s) 298
XbaI TCTAGA 1 cut(s) 217
XmaJI CCTAGG 1 cut(s) 83
XmiI GTMKAC 1 cut(s) 403
XspI CTAG 5 cut(s) 84, 218, 248, 281, 423
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.