RchiOBHm_Chr3g0497281
ERF Family

DNA RNA polymerases superfamily protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
49089660 .. 49090211
552 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 282 bp
ATGTACTCGGTCATTAATGTCGAGAATTTGAAGCTCTTTGAACCATCTCCATTGGATGATGATCCTGACGAAGACACTCGTCTTCCATCAGTCGATGACTTGAAAATGGAGCAAGAAGATCCTTTAGAGGAGGACTGTATATTGGAGCAAAAGGTTTGTGAAACCCGACATGGAAAGTATGAGTATTTCCGCATAGGCAGAAAAGGTCAACTTCCCAGCAAATCTAAGTGGTACATTCGAGCCAAGGCAACTATAGAGTTTCCTCATCTCAAGATACCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

93

Amino Acids

10.97

Weight (kDa)

4.88

Isoelectric Point (pI)

46.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 190
AclWI GGATC 2 cut(s) 56, 113
AcsI RAATTY 1 cut(s) 25
AfaI GTAC 2 cut(s) 5, 233
AgsI TTSAA 3 cut(s) 31, 41, 103
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
AlwI GGATC 2 cut(s) 56, 113
ApoI RAATTY 1 cut(s) 25
AseI ATTAAT 1 cut(s) 15
BbsI GAAGAC 2 cut(s) 74, 78
BccI CCATC 2 cut(s) 52, 94
BfmI CTRYAG 1 cut(s) 252
BoxI GACNNNNGTC 1 cut(s) 78
BpiI GAAGAC 2 cut(s) 74, 78
BpuEI CTTGAG 1 cut(s) 254
BsaBI GATNNNNATC 1 cut(s) 60
BsaJI CCNNGG 1 cut(s) 243
Bse8I GATNNNNATC 1 cut(s) 60
BseDI CCNNGG 1 cut(s) 243
BseGI GGATG 1 cut(s) 61
BseJI GATNNNNATC 1 cut(s) 60
BseRI GAGGAG 1 cut(s) 143
BseYI CCCAGC 1 cut(s) 215
Bsp143I GATC 2 cut(s) 61, 118
BspACI CCGC 1 cut(s) 190
BspPI GGATC 2 cut(s) 56, 113
BssECI CCNNGG 1 cut(s) 243
BssMI GATC 2 cut(s) 61, 118
BssT1I CCWWGG 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 137
BstDEI CTNAG 1 cut(s) 225
BstF5I GGATG 1 cut(s) 61
BstKTI GATC 2 cut(s) 64, 121
BstMBI GATC 2 cut(s) 61, 118
BstPAI GACNNNNGTC 1 cut(s) 78
BstSFI CTRYAG 1 cut(s) 252
BstV2I GAAGAC 2 cut(s) 74, 78
BstX2I RGATCY 1 cut(s) 118
BstYI RGATCY 1 cut(s) 118
BtsCI GGATG 1 cut(s) 61
Csp6I GTAC 2 cut(s) 4, 232
CviAII CATG 1 cut(s) 170
CviJI RGCY 2 cut(s) 34, 242
CviKI_1 RGCY 2 cut(s) 34, 242
CviQI GTAC 2 cut(s) 4, 232
DdeI CTNAG 1 cut(s) 225
DpnI GATC 2 cut(s) 63, 120
DpnII GATC 2 cut(s) 61, 118
Eco130I CCWWGG 1 cut(s) 243
EcoT14I CCWWGG 1 cut(s) 243
ErhI CCWWGG 1 cut(s) 243
FaeI CATG 1 cut(s) 173
FaiI YATR 5 cut(s) 140, 171, 180, 194, 254
FalI AAGNNNNNCTT 2 cut(s) 195, 227
FatI CATG 1 cut(s) 169
FokI GGATG 1 cut(s) 68
GsaI CCCAGC 1 cut(s) 219
Hin1II CATG 1 cut(s) 173
HincII GTYRAC 1 cut(s) 209
HindII GTYRAC 1 cut(s) 209
Hpy166II GTNNAC 1 cut(s) 209
Hpy188III TCNNGA 3 cut(s) 22, 65, 271
Hpy8I GTNNAC 1 cut(s) 209
HpyCH4III ACNGT 1 cut(s) 137
HpyF3I CTNAG 1 cut(s) 225
Hsp92II CATG 1 cut(s) 173
Kzo9I GATC 2 cut(s) 61, 118
LmnI GCTCC 2 cut(s) 109, 145
LpnPI CCDG 2 cut(s) 78, 229
MalI GATC 2 cut(s) 63, 120
MboI GATC 2 cut(s) 61, 118
MboII GAAGA 3 cut(s) 74, 83, 128
MflI RGATCY 1 cut(s) 118
MluCI AATT 1 cut(s) 25
MnlI CCTC 3 cut(s) 121, 124, 273
MseI TTAA 1 cut(s) 15
NdeII GATC 2 cut(s) 61, 118
NlaIII CATG 1 cut(s) 173
PshAI GACNNNNGTC 1 cut(s) 78
PshBI ATTAAT 1 cut(s) 15
PspFI CCCAGC 1 cut(s) 215
PsuI RGATCY 1 cut(s) 118
RsaI GTAC 2 cut(s) 5, 233
RsaNI GTAC 2 cut(s) 4, 232
SaqAI TTAA 1 cut(s) 15
Sau3AI GATC 2 cut(s) 61, 118
SetI ASST 4 cut(s) 36, 156, 208, 280
SfcI CTRYAG 1 cut(s) 252
SmlI CTYRAG 1 cut(s) 269
SmoI CTYRAG 1 cut(s) 269
Sse9I AATT 1 cut(s) 25
SsiI CCGC 1 cut(s) 190
StyI CCWWGG 1 cut(s) 243
TaaI ACNGT 1 cut(s) 137
TaqI TCGA 3 cut(s) 21, 93, 238
TasI AATT 1 cut(s) 25
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
VspI ATTAAT 1 cut(s) 15
XapI RAATTY 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.