RchiOBHm_Chr2g0092451

Arabinogalactan peptide

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
5963357 .. 5963893
537 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 195 bp
ATGGAGATGCTGAGACTTCACTTTTTTGTCATGGCTATTCTCTCTGCAGTCATCATTTCTCTTCTACTACCTTCCACCAATGCTCAGAGCCTCGCACCAGCTCCCGCCCCCACGAGTGATGGGGTAGCAGTTGATCAAGGAATTGCATATGCCCTAATGGCATTTGCTCTGGTGCTCACCTATATCATTCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

6.8

Weight (kDa)

5.2

Isoelectric Point (pI)

45.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AGP PF06376 32 - 64 1.3e-15 Arabinogalactan peptide
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 105
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
Alw21I GWGCWC 1 cut(s) 177
Alw26I GTCTC 1 cut(s) 7
AsuHPI GGTGA 1 cut(s) 169
BauI CACGAG 1 cut(s) 112
Bbv12I GWGCWC 1 cut(s) 177
BccI CCATC 1 cut(s) 113
BclI TGATCA 1 cut(s) 133
BcoDI GTCTC 1 cut(s) 7
BfmI CTRYAG 1 cut(s) 45
BglI GCCNNNNNGGC 1 cut(s) 158
BseMII CTCAG 1 cut(s) 98
BsiHKAI GWGCWC 1 cut(s) 177
BsmAI GTCTC 1 cut(s) 7
Bsp1286I GDGCHC 1 cut(s) 177
Bsp143I GATC 1 cut(s) 133
BspACI CCGC 1 cut(s) 105
BspCNI CTCAG 1 cut(s) 97
BspMAI CTGCAG 1 cut(s) 49
BssMI GATC 1 cut(s) 133
BssSI CACGAG 1 cut(s) 112
Bst2BI CACGAG 1 cut(s) 112
Bst6I CTCTTC 1 cut(s) 66
BstDEI CTNAG 2 cut(s) 11, 84
BstKTI GATC 1 cut(s) 136
BstMAI GTCTC 1 cut(s) 7
BstMBI GATC 1 cut(s) 133
BstMWI GCNNNNNNNGC 1 cut(s) 158
BstSFI CTRYAG 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 190
CviAII CATG 1 cut(s) 31
CviJI RGCY 3 cut(s) 35, 90, 101
CviKI_1 RGCY 3 cut(s) 35, 90, 101
DdeI CTNAG 2 cut(s) 11, 84
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
Eam1104I CTCTTC 1 cut(s) 66
EarI CTCTTC 1 cut(s) 66
FaeI CATG 1 cut(s) 34
FaiI YATR 4 cut(s) 32, 148, 150, 183
FatI CATG 1 cut(s) 30
FauI CCCGC 1 cut(s) 112
FauNDI CATATG 1 cut(s) 148
FbaI TGATCA 1 cut(s) 133
Hin1II CATG 1 cut(s) 34
HphI GGTGA 1 cut(s) 169
Hpy188I TCNGA 1 cut(s) 87
HpyAV CCTTC 1 cut(s) 81
HpyCH4V TGCA 2 cut(s) 47, 146
HpyF10VI GCNNNNNNNGC 1 cut(s) 158
HpyF3I CTNAG 2 cut(s) 11, 84
Hsp92II CATG 1 cut(s) 34
Ksp22I TGATCA 1 cut(s) 133
Kzo9I GATC 1 cut(s) 133
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 2 cut(s) 111, 155
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MboII GAAGA 1 cut(s) 53
MhlI GDGCHC 1 cut(s) 177
MluCI AATT 1 cut(s) 141
MnlI CCTC 1 cut(s) 101
MwoI GCNNNNNNNGC 1 cut(s) 158
NdeI CATATG 1 cut(s) 148
NdeII GATC 1 cut(s) 133
NlaIII CATG 1 cut(s) 34
PstI CTGCAG 1 cut(s) 49
Sau3AI GATC 1 cut(s) 133
SduI GDGCHC 1 cut(s) 177
SetI ASST 3 cut(s) 73, 103, 182
SfcI CTRYAG 1 cut(s) 45
SgeI CNNG 8 cut(s) 43, 104, 110, 116, 124, 126, 149, 182
Sse9I AATT 1 cut(s) 141
SsiI CCGC 1 cut(s) 105
TasI AATT 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.