RchiOBHm_Chr2g0117161

Alkaline neutral invertase CINV2-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
29420404 .. 29421501
1098 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 135 bp
ATGGCGGAGGCTCTTAATTACAATCAGGTACAGGTATTTGTGAGAGATTTTGTTCCTACTGGTTTGGCCTGCCTTCCAGATGGCTTAGATGGGACGCCAGTTGTATCTATGAATTATGACTCGAATTGGTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

44

Amino Acids

4.91

Weight (kDa)

4.05

Isoelectric Point (pI)

35.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AcyI GRCGYC 1 cut(s) 95
AfaI GTAC 1 cut(s) 30
AoxI GGCC 1 cut(s) 66
BccI CCATC 2 cut(s) 74, 83
BsaHI GRCGYC 1 cut(s) 95
Bse1I ACTGG 2 cut(s) 64, 98
BseNI ACTGG 2 cut(s) 64, 98
BshFI GGCC 1 cut(s) 68
BslFI GGGAC 1 cut(s) 106
BsmFI GGGAC 1 cut(s) 106
BsnI GGCC 1 cut(s) 68
BspACI CCGC 1 cut(s) 5
BspANI GGCC 1 cut(s) 68
BsrI ACTGG 2 cut(s) 64, 98
BssNI GRCGYC 1 cut(s) 95
BstACI GRCGYC 1 cut(s) 95
BstC8I GCNNGC 1 cut(s) 70
BstDEI CTNAG 1 cut(s) 85
BsuRI GGCC 1 cut(s) 68
Cac8I GCNNGC 1 cut(s) 70
CseI GACGC 1 cut(s) 103
Csp6I GTAC 1 cut(s) 29
CviJI RGCY 3 cut(s) 11, 68, 84
CviKI_1 RGCY 3 cut(s) 11, 68, 84
CviQI GTAC 1 cut(s) 29
DdeI CTNAG 1 cut(s) 85
EciI GGCGGA 1 cut(s) 20
FaiI YATR 2 cut(s) 110, 117
FaqI GGGAC 1 cut(s) 106
HaeIII GGCC 1 cut(s) 68
HgaI GACGC 1 cut(s) 103
Hin1I GRCGYC 1 cut(s) 95
HinfI GANTC 1 cut(s) 119
Hpy188III TCNNGA 1 cut(s) 77
HpyAV CCTTC 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 85
Hsp92I GRCGYC 1 cut(s) 95
LpnPI CCDG 6 cut(s) 11, 17, 45, 82, 90, 111
MluCI AATT 3 cut(s) 16, 112, 124
MlyI GAGTC 1 cut(s) 113
MseI TTAA 1 cut(s) 15
PleI GAGTC 1 cut(s) 113
PpsI GAGTC 1 cut(s) 113
RsaI GTAC 1 cut(s) 30
RsaNI GTAC 1 cut(s) 29
SaqAI TTAA 1 cut(s) 15
SchI GAGTC 1 cut(s) 113
SetI ASST 2 cut(s) 30, 36
SgeI CNNG 6 cut(s) 38, 44, 72, 81, 89, 110
Sse9I AATT 3 cut(s) 16, 112, 124
SsiI CCGC 1 cut(s) 5
TaqI TCGA 1 cut(s) 122
TasI AATT 3 cut(s) 16, 112, 124
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TspDTI ATGAA 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.