RchiOBHm_Chr1g0322101

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
9570272 .. 9570637
366 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 237 bp
ATGACATTAATTAGTATCGACGCTGGAACCTATACGCTCTTGGTACGTGGGATGTGCAAGAATGGTAAACTCGAAAACACTTGCTCCTTCTTTGAGGAGATGGCATTGAAGGGTTTTGTTCCCAAGGACAGTACATACAAGATGTTGCTAGAGGAATTGCAGGGGAAGAATATGGAGAAAGAGAAGAAACATATTGAGAAGTTGATGTTGCGGGCAAGAGAGCAAGGAAACGTATAA

Protein Analysis

78

Amino Acids

8.96

Weight (kDa)

8.6

Isoelectric Point (pI)

35.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_1 PF12854 5 - 34 9.5e-08 PPR repeat
PPR_2 PF13041 7 - 52 2.8e-09 PPR repeat family
PPR PF01535 10 - 39 5.7e-06 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 211
AfaI GTAC 2 cut(s) 45, 133
AgsI TTSAA 1 cut(s) 109
AseI ATTAAT 1 cut(s) 8
BccI CCATC 1 cut(s) 94
BfaI CTAG 1 cut(s) 149
BmiI GGNNCC 1 cut(s) 28
BsaAI YACGTR 1 cut(s) 47
BsaJI CCNNGG 1 cut(s) 123
BsaXI ACNNNNNCTCC 2 cut(s) 68, 98
BseDI CCNNGG 1 cut(s) 123
BseGI GGATG 1 cut(s) 57
BseRI GAGGAG 1 cut(s) 110
BspACI CCGC 1 cut(s) 211
BspLI GGNNCC 1 cut(s) 28
BssECI CCNNGG 1 cut(s) 123
BssT1I CCWWGG 1 cut(s) 123
Bst4CI ACNGT 1 cut(s) 131
BstBAI YACGTR 1 cut(s) 47
BstC8I GCNNGC 1 cut(s) 213
BstF5I GGATG 1 cut(s) 57
BtsCI GGATG 1 cut(s) 57
Cac8I GCNNGC 1 cut(s) 213
CseI GACGC 1 cut(s) 29
Csp6I GTAC 2 cut(s) 44, 132
CviQI GTAC 2 cut(s) 44, 132
Eco130I CCWWGG 1 cut(s) 123
EcoT14I CCWWGG 1 cut(s) 123
ErhI CCWWGG 1 cut(s) 123
FaiI YATR 5 cut(s) 33, 136, 173, 192, 235
FauI CCCGC 1 cut(s) 204
FokI GGATG 1 cut(s) 64
FspBI CTAG 1 cut(s) 149
HgaI GACGC 1 cut(s) 29
Hpy166II GTNNAC 1 cut(s) 68
Hpy8I GTNNAC 1 cut(s) 68
Hpy99I CGWCG 1 cut(s) 23
HpyAV CCTTC 2 cut(s) 97, 103
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4IV ACGT 2 cut(s) 46, 231
HpyCH4V TGCA 2 cut(s) 57, 160
HpySE526I ACGT 2 cut(s) 46, 231
LmnI GCTCC 1 cut(s) 89
LpnPI CCDG 2 cut(s) 9, 146
MaeI CTAG 1 cut(s) 149
MaeII ACGT 2 cut(s) 46, 231
MboII GAAGA 2 cut(s) 178, 196
MluCI AATT 2 cut(s) 9, 155
MnlI CCTC 2 cut(s) 88, 145
MseI TTAA 1 cut(s) 8
NlaIV GGNNCC 1 cut(s) 28
Ppu21I YACGTR 1 cut(s) 47
PshBI ATTAAT 1 cut(s) 8
PspN4I GGNNCC 1 cut(s) 28
RsaI GTAC 2 cut(s) 45, 133
RsaNI GTAC 2 cut(s) 44, 132
SaqAI TTAA 1 cut(s) 8
SetI ASST 3 cut(s) 32, 49, 234
Sse9I AATT 2 cut(s) 9, 155
SsiI CCGC 1 cut(s) 211
SspMI CTAG 1 cut(s) 149
StyI CCWWGG 1 cut(s) 123
TaaI ACNGT 1 cut(s) 131
TaiI ACGT 2 cut(s) 49, 234
TaqI TCGA 2 cut(s) 18, 72
TasI AATT 2 cut(s) 9, 155
TatI WGTACW 1 cut(s) 131
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
VspI ATTAAT 1 cut(s) 8
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.