RchiOBHm_Chr1g0360691

WD repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
52522029 .. 52522703
675 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 141 bp
ATGTACAATGTAAAGCTTGTCTCAAGCAATGCTACATTAGAGGCTTCTTTTAGCCTAGATGGGATGTTTGTTATGTCAGCTCAAAGAGAGAAGATAAGTGAAGCTAATCAAGGTATGCTTTGGATCTACATATGTGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

46

Amino Acids

5.19

Weight (kDa)

4.65

Isoelectric Point (pI)

36.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 131
AfaI GTAC 1 cut(s) 5
AluBI AGCT 3 cut(s) 16, 80, 104
AluI AGCT 3 cut(s) 16, 80, 104
Alw26I GTCTC 1 cut(s) 25
AlwI GGATC 1 cut(s) 131
BccI CCATC 1 cut(s) 53
BcoDI GTCTC 1 cut(s) 25
BfaI CTAG 1 cut(s) 56
BpuEI CTTGAG 1 cut(s) 7
Bse3DI GCAATG 1 cut(s) 34
BseGI GGATG 1 cut(s) 69
BseMI GCAATG 1 cut(s) 34
BsmAI GTCTC 1 cut(s) 25
Bsp1407I TGTACA 1 cut(s) 3
Bsp143I GATC 1 cut(s) 123
BspPI GGATC 1 cut(s) 131
BsrDI GCAATG 1 cut(s) 34
BsrGI TGTACA 1 cut(s) 3
BssMI GATC 1 cut(s) 123
BstAUI TGTACA 1 cut(s) 3
BstF5I GGATG 1 cut(s) 69
BstKTI GATC 1 cut(s) 126
BstMAI GTCTC 1 cut(s) 25
BstMBI GATC 1 cut(s) 123
BstX2I RGATCY 1 cut(s) 123
BstYI RGATCY 1 cut(s) 123
BtsCI GGATG 1 cut(s) 69
Csp6I GTAC 1 cut(s) 4
CviJI RGCY 5 cut(s) 16, 44, 54, 80, 104
CviKI_1 RGCY 5 cut(s) 16, 44, 54, 80, 104
CviQI GTAC 1 cut(s) 4
DpnI GATC 1 cut(s) 125
DpnII GATC 1 cut(s) 123
FaiI YATR 4 cut(s) 74, 116, 131, 133
FalI AAGNNNNNCTT 2 cut(s) 102, 134
FauNDI CATATG 1 cut(s) 131
FokI GGATG 1 cut(s) 76
FspBI CTAG 1 cut(s) 56
FspEI CC 6 cut(s) 26, 45, 46, 68, 96, 106
HindIII AAGCTT 1 cut(s) 14
Kzo9I GATC 1 cut(s) 123
MaeI CTAG 1 cut(s) 56
MalI GATC 1 cut(s) 125
MboI GATC 1 cut(s) 123
MboII GAAGA 1 cut(s) 103
MflI RGATCY 1 cut(s) 123
MnlI CCTC 1 cut(s) 34
MseI TTAA 1 cut(s) 139
NdeI CATATG 1 cut(s) 131
NdeII GATC 1 cut(s) 123
PsuI RGATCY 1 cut(s) 123
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 139
Sau3AI GATC 1 cut(s) 123
SetI ASST 4 cut(s) 18, 82, 106, 115
SgeI CNNG 4 cut(s) 29, 36, 68, 122
SmlI CTYRAG 1 cut(s) 22
SmoI CTYRAG 1 cut(s) 22
SspMI CTAG 1 cut(s) 56
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 1 cut(s) 139
Tru9I TTAA 1 cut(s) 139
XspI CTAG 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.