Rw4G029590

WD repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Reverse (-)
56247989 .. 56253809
5821 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G029590.1

Sequence Viewer

Length: 195 bp
ATGTCTGATGCAAATGTTGTGAAGTTCAGGAATGATGGGAGACTTATGCTGTTAACTATTTCAAATGGACATATTCATTTATCCATGTACAATGTAAAGCTTGTCTCAAGCAATGCTACATTAGAGGCTTCTTTTAGCCCAGATGGGATGTTTGTTATGTCAGGACGCAGTTGGATCTCAATGTCCAATTTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.08

Weight (kDa)

8.29

Isoelectric Point (pI)

55.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 182
AfaI GTAC 1 cut(s) 89
AgsI TTSAA 1 cut(s) 63
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
Alw26I GTCTC 2 cut(s) 34, 109
AlwI GGATC 1 cut(s) 182
BccI CCATC 2 cut(s) 29, 137
BcoDI GTCTC 2 cut(s) 34, 109
BpuEI CTTGAG 1 cut(s) 91
Bse3DI GCAATG 1 cut(s) 118
BseGI GGATG 1 cut(s) 153
BseMI GCAATG 1 cut(s) 118
BsmAI GTCTC 2 cut(s) 34, 109
Bsp1407I TGTACA 1 cut(s) 87
Bsp143I GATC 1 cut(s) 174
BspPI GGATC 1 cut(s) 182
BsrDI GCAATG 1 cut(s) 118
BsrGI TGTACA 1 cut(s) 87
BssMI GATC 1 cut(s) 174
BstAUI TGTACA 1 cut(s) 87
BstF5I GGATG 1 cut(s) 153
BstKTI GATC 1 cut(s) 177
BstMAI GTCTC 2 cut(s) 34, 109
BstMBI GATC 1 cut(s) 174
BstX2I RGATCY 1 cut(s) 174
BstYI RGATCY 1 cut(s) 174
BtsCI GGATG 1 cut(s) 153
CseI GACGC 1 cut(s) 174
Csp6I GTAC 1 cut(s) 88
CviAII CATG 1 cut(s) 85
CviJI RGCY 3 cut(s) 100, 128, 138
CviKI_1 RGCY 3 cut(s) 100, 128, 138
CviQI GTAC 1 cut(s) 88
DpnI GATC 1 cut(s) 176
DpnII GATC 1 cut(s) 174
FaeI CATG 1 cut(s) 88
FaiI YATR 5 cut(s) 47, 72, 86, 158, 193
FatI CATG 1 cut(s) 84
FokI GGATG 1 cut(s) 160
HgaI GACGC 1 cut(s) 174
Hin1II CATG 1 cut(s) 88
HincII GTYRAC 1 cut(s) 54
HindII GTYRAC 1 cut(s) 54
HindIII AAGCTT 1 cut(s) 98
HpaI GTTAAC 1 cut(s) 54
Hpy166II GTNNAC 1 cut(s) 54
Hpy188I TCNGA 1 cut(s) 7
Hpy188III TCNNGA 2 cut(s) 28, 162
Hpy8I GTNNAC 1 cut(s) 54
HpyCH4V TGCA 1 cut(s) 11
Hsp92II CATG 1 cut(s) 88
KspAI GTTAAC 1 cut(s) 54
Kzo9I GATC 1 cut(s) 174
LpnPI CCDG 3 cut(s) 13, 147, 153
MalI GATC 1 cut(s) 176
MboI GATC 1 cut(s) 174
MflI RGATCY 1 cut(s) 174
MluCI AATT 1 cut(s) 187
MmeI TCCRAC 1 cut(s) 152
MnlI CCTC 1 cut(s) 118
MseI TTAA 1 cut(s) 53
NdeII GATC 1 cut(s) 174
NlaIII CATG 1 cut(s) 88
PsuI RGATCY 1 cut(s) 174
RsaI GTAC 1 cut(s) 89
RsaNI GTAC 1 cut(s) 88
SaqAI TTAA 1 cut(s) 53
Sau3AI GATC 1 cut(s) 174
SetI ASST 1 cut(s) 102
SgeI CNNG 6 cut(s) 40, 97, 113, 120, 152, 174
SmlI CTYRAG 1 cut(s) 106
SmoI CTYRAG 1 cut(s) 106
Sse9I AATT 1 cut(s) 187
TasI AATT 1 cut(s) 187
TatI WGTACW 1 cut(s) 87
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
TspDTI ATGAA 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.