RchiOBHm_Chr6g0289991

WD repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
53079951 .. 53081397
1447 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ26015

Sequence Viewer

Length: 192 bp
ATGTACAATGTAAAGCTTGTCTCAAGCAATGCTACATTAGAGGCTTCTTTTAGCCCAGATGGGATGTTTGTTATGTCAGGTATGCTTGCTCAATTTCTCTGGTGTGAAATTTCTTGCAGCAAAATTAGTTCAGAACTTGTTGCATCCTTTGGAATAAATTTAAATTGGCTTTTCAATATATGCCTTGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

6.92

Weight (kDa)

4.41

Isoelectric Point (pI)

52.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 108, 157
AfaI GTAC 1 cut(s) 5
AgsI TTSAA 1 cut(s) 175
AluBI AGCT 1 cut(s) 16
AluI AGCT 1 cut(s) 16
Alw26I GTCTC 1 cut(s) 25
ApeKI GCWGC 1 cut(s) 117
ApoI RAATTY 2 cut(s) 108, 157
BbvI GCAGC 1 cut(s) 129
BccI CCATC 1 cut(s) 53
BcoDI GTCTC 1 cut(s) 25
BisI GCNGC 1 cut(s) 118
BlsI GCNGC 1 cut(s) 119
BmsI GCATC 1 cut(s) 152
BpuEI CTTGAG 1 cut(s) 7
BsaJI CCNNGG 1 cut(s) 184
Bse3DI GCAATG 1 cut(s) 34
BseDI CCNNGG 1 cut(s) 184
BseGI GGATG 2 cut(s) 69, 143
BseMI GCAATG 1 cut(s) 34
BseXI GCAGC 1 cut(s) 129
BsmAI GTCTC 1 cut(s) 25
Bsp1407I TGTACA 1 cut(s) 3
BsrDI GCAATG 1 cut(s) 34
BsrGI TGTACA 1 cut(s) 3
BssECI CCNNGG 1 cut(s) 184
BssT1I CCWWGG 1 cut(s) 184
BstAUI TGTACA 1 cut(s) 3
BstC8I GCNNGC 1 cut(s) 87
BstF5I GGATG 2 cut(s) 69, 143
BstMAI GTCTC 1 cut(s) 25
BstV1I GCAGC 1 cut(s) 129
BtsCI GGATG 2 cut(s) 69, 143
Cac8I GCNNGC 1 cut(s) 87
Csp6I GTAC 1 cut(s) 4
CviJI RGCY 4 cut(s) 16, 44, 54, 169
CviKI_1 RGCY 4 cut(s) 16, 44, 54, 169
CviQI GTAC 1 cut(s) 4
DraI TTTAAA 1 cut(s) 162
Eco130I CCWWGG 1 cut(s) 184
EcoT14I CCWWGG 1 cut(s) 184
ErhI CCWWGG 1 cut(s) 184
FaiI YATR 4 cut(s) 74, 83, 179, 181
Fnu4HI GCNGC 1 cut(s) 118
FokI GGATG 2 cut(s) 76, 130
Fsp4HI GCNGC 1 cut(s) 118
GluI GCNGC 1 cut(s) 118
HindIII AAGCTT 1 cut(s) 14
Hpy188I TCNGA 1 cut(s) 133
HpyCH4V TGCA 2 cut(s) 117, 143
LpnPI CCDG 3 cut(s) 63, 69, 85
Lsp1109I GCAGC 1 cut(s) 129
LweI GCATC 1 cut(s) 152
MluCI AATT 5 cut(s) 92, 108, 123, 157, 163
MnlI CCTC 1 cut(s) 34
MseI TTAA 1 cut(s) 161
PkrI GCNGC 1 cut(s) 119
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 161
SatI GCNGC 1 cut(s) 118
SetI ASST 2 cut(s) 18, 82
SfaNI GCATC 1 cut(s) 152
SgeI CNNG 8 cut(s) 29, 36, 68, 90, 98, 112, 126, 149
SmiI ATTTAAAT 1 cut(s) 162
SmlI CTYRAG 1 cut(s) 22
SmoI CTYRAG 1 cut(s) 22
Sse9I AATT 5 cut(s) 92, 108, 123, 157, 163
StyI CCWWGG 1 cut(s) 184
SwaI ATTTAAAT 1 cut(s) 162
TasI AATT 5 cut(s) 92, 108, 123, 157, 163
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 1 cut(s) 161
Tru9I TTAA 1 cut(s) 161
TseI GCWGC 1 cut(s) 117
XapI RAATTY 2 cut(s) 108, 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.