RchiOBHm_Chr1g0326231

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
14473319 .. 14477500
4182 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55587

Sequence Viewer

Length: 231 bp
ATGAGCTACTTTGTAGTCATGGTCACCGAAGAGCCTAAAGACCCGTTGAGACGGGTGAACTGGAAAGGTGTTGGTAGTGATATGCAGAAGAGGCCCTATGGTAAACCAGGCATAATGAAACGGCTTCCCAGAAAGATTAGTCTGAATCCAGATTGCTATTTTCTTCCTCTGAAGTTACTACCCTACAACATTGCATCCTTAGAAGCATGTAATGCTGTTGGATATATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.74

Weight (kDa)

9.59

Isoelectric Point (pI)

53.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 191
AjnI CCWGG 1 cut(s) 106
AluBI AGCT 1 cut(s) 6
AluI AGCT 1 cut(s) 6
Alw26I GTCTC 1 cut(s) 43
AoxI GGCC 1 cut(s) 92
AspS9I GGNCC 1 cut(s) 93
AsuHPI GGTGA 2 cut(s) 16, 67
BceAI ACGGC 1 cut(s) 137
BciT130I CCWGG 1 cut(s) 108
BcoDI GTCTC 1 cut(s) 43
Bme1390I CCNGG 1 cut(s) 108
BmgT120I GGNCC 1 cut(s) 93
BmrFI CCNGG 1 cut(s) 108
BmsI GCATC 1 cut(s) 203
Bse1I ACTGG 1 cut(s) 65
Bse3DI GCAATG 1 cut(s) 189
BseBI CCWGG 1 cut(s) 108
BseGI GGATG 1 cut(s) 194
BseMI GCAATG 1 cut(s) 189
BseNI ACTGG 1 cut(s) 65
BshFI GGCC 1 cut(s) 94
BsmAI GTCTC 1 cut(s) 43
BsmBI CGTCTC 1 cut(s) 43
BsnI GGCC 1 cut(s) 94
BspANI GGCC 1 cut(s) 94
BspQI GCTCTTC 1 cut(s) 24
BsrDI GCAATG 1 cut(s) 189
BsrI ACTGG 1 cut(s) 65
Bst2UI CCWGG 1 cut(s) 108
Bst6I CTCTTC 2 cut(s) 24, 83
BstAPI GCANNNNNTGC 1 cut(s) 212
BstDEI CTNAG 1 cut(s) 199
BstEII GGTNACC 1 cut(s) 22
BstF5I GGATG 1 cut(s) 194
BstMAI GTCTC 1 cut(s) 43
BstMWI GCNNNNNNNGC 2 cut(s) 91, 212
BstNI CCWGG 1 cut(s) 108
BstNSI RCATGY 1 cut(s) 210
BstPI GGTNACC 1 cut(s) 22
BstSCI CCNGG 1 cut(s) 106
BsuRI GGCC 1 cut(s) 94
BtsCI GGATG 1 cut(s) 194
Cfr13I GGNCC 1 cut(s) 93
CviAII CATG 2 cut(s) 19, 207
CviJI RGCY 4 cut(s) 6, 34, 94, 124
CviKI_1 RGCY 4 cut(s) 6, 34, 94, 124
DdeI CTNAG 1 cut(s) 199
Eam1104I CTCTTC 2 cut(s) 24, 83
EarI CTCTTC 2 cut(s) 24, 83
Eco57I CTGAAG 1 cut(s) 191
Eco91I GGTNACC 1 cut(s) 22
EcoO109I RGGNCCY 1 cut(s) 93
EcoO65I GGTNACC 1 cut(s) 22
EcoRII CCWGG 1 cut(s) 106
Esp3I CGTCTC 1 cut(s) 43
FaeI CATG 2 cut(s) 22, 210
FaiI YATR 7 cut(s) 20, 83, 99, 113, 208, 225, 227
FatI CATG 2 cut(s) 18, 206
FokI GGATG 1 cut(s) 181
HaeIII GGCC 1 cut(s) 94
Hin1II CATG 2 cut(s) 22, 210
HinfI GANTC 1 cut(s) 145
HphI GGTGA 2 cut(s) 16, 67
Hpy166II GTNNAC 2 cut(s) 58, 104
Hpy188I TCNGA 2 cut(s) 144, 171
Hpy188III TCNNGA 1 cut(s) 149
Hpy8I GTNNAC 2 cut(s) 58, 104
HpyCH4V TGCA 2 cut(s) 85, 194
HpyF10VI GCNNNNNNNGC 2 cut(s) 91, 212
HpyF3I CTNAG 1 cut(s) 199
Hsp92II CATG 2 cut(s) 22, 210
LguI GCTCTTC 1 cut(s) 24
LpnPI CCDG 5 cut(s) 46, 93, 120, 142, 162
LweI GCATC 1 cut(s) 203
MaeIII GTNAC 2 cut(s) 22, 174
MboII GAAGA 3 cut(s) 41, 100, 155
MmeI TCCRAC 1 cut(s) 199
MnlI CCTC 2 cut(s) 84, 177
MspR9I CCNGG 1 cut(s) 108
MvaI CCWGG 1 cut(s) 108
MwoI GCNNNNNNNGC 2 cut(s) 91, 212
NlaIII CATG 2 cut(s) 22, 210
NmuCI GTSAC 1 cut(s) 22
NspI RCATGY 1 cut(s) 210
PciSI GCTCTTC 1 cut(s) 24
PfeI GAWTC 1 cut(s) 145
Psp6I CCWGG 1 cut(s) 106
PspEI GGTNACC 1 cut(s) 22
PspGI CCWGG 1 cut(s) 106
PspPI GGNCC 1 cut(s) 93
SapI GCTCTTC 1 cut(s) 24
Sau96I GGNCC 1 cut(s) 93
ScrFI CCNGG 1 cut(s) 108
SetI ASST 2 cut(s) 8, 70
SfaNI GCATC 1 cut(s) 203
SgeI CNNG 9 cut(s) 31, 55, 65, 73, 119, 120, 141, 161, 219
StyD4I CCNGG 1 cut(s) 106
TfiI GAWTC 1 cut(s) 145
TseFI GTSAC 1 cut(s) 22
Tsp45I GTSAC 1 cut(s) 22
TspDTI ATGAA 1 cut(s) 131
XceI RCATGY 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.