Rh3CG042100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
2833290 .. 2833556
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG042100.1

Sequence Viewer

Length: 267 bp
ATGGGCACTGAAGAAACAAATGACCCTTTCAAAGGGGTAGCTTGGAAAGCTGTTGGTAGTGATATGCAGAAGAACCCTGGTGATAAACCGTGTATGAAGAAGCGGCTTCCCAAAATGATCGGGCAGATTCCAGAATGCTATTTTCTTCCTTGTAGATCCCTGCTCTATAATATTACCTTTTCTGGAGCATATATTGCTGGTGGAATTGGTGAGGGAATGCTGGAGGAGATGTGGATCAACAAGAAAGAGAGGATGGAGGCATACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.94

Weight (kDa)

7.65

Isoelectric Point (pI)

45.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 103
AclWI GGATC 2 cut(s) 150, 242
AcuI CTGAAG 1 cut(s) 30
AfiI CCNNNNNNNGG 1 cut(s) 32
AgsI TTSAA 1 cut(s) 31
AjnI CCWGG 1 cut(s) 76
AluBI AGCT 2 cut(s) 41, 50
AluI AGCT 2 cut(s) 41, 50
AlwI GGATC 2 cut(s) 150, 242
AsuHPI GGTGA 2 cut(s) 92, 221
BaeGI GKGCMC 1 cut(s) 8
BccI CCATC 1 cut(s) 247
BciT130I CCWGG 1 cut(s) 78
BfaI CTAG 1 cut(s) 265
BisI GCNGC 1 cut(s) 104
BlsI GCNGC 1 cut(s) 105
Bme1390I CCNGG 1 cut(s) 78
BmrFI CCNGG 1 cut(s) 78
BpmI CTGGAG 2 cut(s) 204, 242
BsaBI GATNNNNATC 1 cut(s) 233
BsaJI CCNNGG 1 cut(s) 76
BsaXI ACNNNNNCTCC 2 cut(s) 215, 245
Bsc4I CCNNNNNNNGG 1 cut(s) 32
Bse8I GATNNNNATC 1 cut(s) 233
BseBI CCWGG 1 cut(s) 78
BseDI CCNNGG 1 cut(s) 76
BseGI GGATG 1 cut(s) 258
BseJI GATNNNNATC 1 cut(s) 233
BseLI CCNNNNNNNGG 1 cut(s) 32
BseRI GAGGAG 1 cut(s) 239
BseSI GKGCMC 1 cut(s) 8
BslI CCNNNNNNNGG 1 cut(s) 32
BsmI GAATGC 2 cut(s) 140, 222
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 3 cut(s) 117, 155, 234
BspACI CCGC 1 cut(s) 103
BspPI GGATC 2 cut(s) 150, 242
BssECI CCNNGG 1 cut(s) 76
BssMI GATC 3 cut(s) 117, 155, 234
Bst2UI CCWGG 1 cut(s) 78
Bst4CI ACNGT 1 cut(s) 90
BstAPI GCANNNNNTGC 1 cut(s) 194
BstENI CCTNNNNNAGG 1 cut(s) 30
BstF5I GGATG 1 cut(s) 258
BstKTI GATC 3 cut(s) 120, 158, 237
BstMBI GATC 3 cut(s) 117, 155, 234
BstMWI GCNNNNNNNGC 2 cut(s) 47, 194
BstNI CCWGG 1 cut(s) 78
BstSCI CCNGG 1 cut(s) 76
BstSLI GKGCMC 1 cut(s) 8
BstX2I RGATCY 1 cut(s) 155
BstYI RGATCY 1 cut(s) 155
BtsCI GGATG 1 cut(s) 258
BtsIMutI CAGTG 1 cut(s) 6
CviJI RGCY 3 cut(s) 41, 50, 106
CviKI_1 RGCY 3 cut(s) 41, 50, 106
DpnI GATC 3 cut(s) 119, 157, 236
DpnII GATC 3 cut(s) 117, 155, 234
Eco57I CTGAAG 1 cut(s) 30
EcoNI CCTNNNNNAGG 1 cut(s) 30
EcoRII CCWGG 1 cut(s) 76
FaiI YATR 6 cut(s) 65, 95, 168, 190, 192, 262
Fnu4HI GCNGC 1 cut(s) 104
Fsp4HI GCNGC 1 cut(s) 104
FspBI CTAG 1 cut(s) 265
GluI GCNGC 1 cut(s) 104
GsuI CTGGAG 2 cut(s) 204, 242
HinfI GANTC 1 cut(s) 127
HphI GGTGA 2 cut(s) 92, 221
Hpy188III TCNNGA 2 cut(s) 131, 183
HpyCH4III ACNGT 1 cut(s) 90
HpyCH4V TGCA 1 cut(s) 67
HpyF10VI GCNNNNNNNGC 2 cut(s) 47, 194
Kzo9I GATC 3 cut(s) 117, 155, 234
LmnI GCTCC 1 cut(s) 185
LpnPI CCDG 7 cut(s) 63, 90, 144, 168, 173, 183, 206
MaeI CTAG 1 cut(s) 265
MalI GATC 3 cut(s) 119, 157, 236
MboI GATC 3 cut(s) 117, 155, 234
MboII GAAGA 4 cut(s) 23, 82, 109, 137
MflI RGATCY 1 cut(s) 155
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 1 cut(s) 204
MnlI CCTC 4 cut(s) 205, 217, 243, 250
MspR9I CCNGG 1 cut(s) 78
Mva1269I GAATGC 2 cut(s) 140, 222
MvaI CCWGG 1 cut(s) 78
MwoI GCNNNNNNNGC 2 cut(s) 47, 194
NdeII GATC 3 cut(s) 117, 155, 234
PctI GAATGC 2 cut(s) 140, 222
PfeI GAWTC 1 cut(s) 127
PkrI GCNGC 1 cut(s) 105
Psp6I CCWGG 1 cut(s) 76
PspGI CCWGG 1 cut(s) 76
PsuI RGATCY 1 cut(s) 155
SatI GCNGC 1 cut(s) 104
Sau3AI GATC 3 cut(s) 117, 155, 234
ScrFI CCNGG 1 cut(s) 78
SduI GDGCHC 1 cut(s) 8
SetI ASST 3 cut(s) 43, 52, 179
Sse9I AATT 1 cut(s) 204
SsiI CCGC 1 cut(s) 103
SspI AATATT 1 cut(s) 172
SspMI CTAG 1 cut(s) 265
StyD4I CCNGG 1 cut(s) 76
TaaI ACNGT 1 cut(s) 90
TasI AATT 1 cut(s) 204
TauI GCSGC 1 cut(s) 106
TfiI GAWTC 1 cut(s) 127
TscAI CASTG 1 cut(s) 13
TspDTI ATGAA 1 cut(s) 110
TspRI CASTG 1 cut(s) 13
XagI CCTNNNNNAGG 1 cut(s) 30
XspI CTAG 1 cut(s) 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.