Rroxscaffold_4G00323930

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
55145012 .. 55145852
841 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00323930.1

Sequence Viewer

Length: 249 bp
ATGGTCACCGAAGAGCCTAAAGACCCGTTGAGACGGGTGAACTCGAAAGCTGTTGGTAGTGATATGCACAGGAGGCCCTATGGTAAACCAGGCATAATGAAACGACTTCCCAGAAAGATTAGTCTGAATCCAGATTGCTATTTTCTTCCTCCTAAGTTACTACCCTACAACATTGCATCCCTAGGAGCATGTATTGAGTATGGAGGTATAATATGGATTTTGACAAATAAAGCTTGGAGGAGTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.35

Weight (kDa)

9.94

Isoelectric Point (pI)

70.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 88
AluBI AGCT 2 cut(s) 50, 233
AluI AGCT 2 cut(s) 50, 233
Alw26I GTCTC 1 cut(s) 25
AoxI GGCC 1 cut(s) 74
AspA2I CCTAGG 1 cut(s) 181
AspS9I GGNCC 1 cut(s) 75
AsuHPI GGTGA 1 cut(s) 49
AvrII CCTAGG 1 cut(s) 181
BciT130I CCWGG 1 cut(s) 90
BcoDI GTCTC 1 cut(s) 25
BfaI CTAG 1 cut(s) 182
BlnI CCTAGG 1 cut(s) 181
Bme1390I CCNGG 1 cut(s) 90
BmgT120I GGNCC 1 cut(s) 75
BmrFI CCNGG 1 cut(s) 90
BmsI GCATC 1 cut(s) 185
BsaJI CCNNGG 1 cut(s) 181
Bse3DI GCAATG 1 cut(s) 171
BseBI CCWGG 1 cut(s) 90
BseDI CCNNGG 1 cut(s) 181
BseGI GGATG 1 cut(s) 176
BseMI GCAATG 1 cut(s) 171
BshFI GGCC 1 cut(s) 76
BsmAI GTCTC 1 cut(s) 25
BsmBI CGTCTC 1 cut(s) 25
BsnI GGCC 1 cut(s) 76
BspANI GGCC 1 cut(s) 76
BspQI GCTCTTC 1 cut(s) 6
BsrDI GCAATG 1 cut(s) 171
BssECI CCNNGG 1 cut(s) 181
BssT1I CCWWGG 1 cut(s) 181
Bst2UI CCWGG 1 cut(s) 90
Bst6I CTCTTC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 153
BstEII GGTNACC 1 cut(s) 4
BstF5I GGATG 1 cut(s) 176
BstMAI GTCTC 1 cut(s) 25
BstMWI GCNNNNNNNGC 1 cut(s) 73
BstNI CCWGG 1 cut(s) 90
BstNSI RCATGY 1 cut(s) 192
BstPI GGTNACC 1 cut(s) 4
BstSCI CCNGG 1 cut(s) 88
BsuRI GGCC 1 cut(s) 76
BtsCI GGATG 1 cut(s) 176
Cfr13I GGNCC 1 cut(s) 75
CviAII CATG 1 cut(s) 189
CviJI RGCY 4 cut(s) 16, 50, 76, 233
CviKI_1 RGCY 4 cut(s) 16, 50, 76, 233
DdeI CTNAG 1 cut(s) 153
Eam1104I CTCTTC 1 cut(s) 6
EarI CTCTTC 1 cut(s) 6
Eco130I CCWWGG 1 cut(s) 181
Eco91I GGTNACC 1 cut(s) 4
EcoO109I RGGNCCY 1 cut(s) 75
EcoO65I GGTNACC 1 cut(s) 4
EcoRII CCWGG 1 cut(s) 88
EcoT14I CCWWGG 1 cut(s) 181
ErhI CCWWGG 1 cut(s) 181
Esp3I CGTCTC 1 cut(s) 25
FaeI CATG 1 cut(s) 192
FaiI YATR 7 cut(s) 65, 81, 95, 190, 201, 209, 214
FatI CATG 1 cut(s) 188
FokI GGATG 1 cut(s) 163
FspBI CTAG 1 cut(s) 182
HaeIII GGCC 1 cut(s) 76
Hin1II CATG 1 cut(s) 192
HindIII AAGCTT 1 cut(s) 231
HinfI GANTC 1 cut(s) 127
HphI GGTGA 1 cut(s) 49
Hpy166II GTNNAC 2 cut(s) 40, 86
Hpy188I TCNGA 1 cut(s) 126
Hpy188III TCNNGA 1 cut(s) 131
Hpy8I GTNNAC 2 cut(s) 40, 86
HpyCH4V TGCA 2 cut(s) 67, 176
HpyF10VI GCNNNNNNNGC 1 cut(s) 73
HpyF3I CTNAG 1 cut(s) 153
Hsp92II CATG 1 cut(s) 192
LguI GCTCTTC 1 cut(s) 6
LmnI GCTCC 1 cut(s) 185
LpnPI CCDG 5 cut(s) 55, 75, 102, 124, 144
LweI GCATC 1 cut(s) 185
MaeI CTAG 1 cut(s) 182
MaeIII GTNAC 2 cut(s) 4, 156
MboII GAAGA 2 cut(s) 23, 137
MnlI CCTC 4 cut(s) 66, 159, 197, 231
MspR9I CCNGG 1 cut(s) 90
MvaI CCWGG 1 cut(s) 90
MwoI GCNNNNNNNGC 1 cut(s) 73
NlaIII CATG 1 cut(s) 192
NmuCI GTSAC 1 cut(s) 4
NspI RCATGY 1 cut(s) 192
PciSI GCTCTTC 1 cut(s) 6
PfeI GAWTC 1 cut(s) 127
Psp6I CCWGG 1 cut(s) 88
PspEI GGTNACC 1 cut(s) 4
PspGI CCWGG 1 cut(s) 88
PspPI GGNCC 1 cut(s) 75
SapI GCTCTTC 1 cut(s) 6
Sau96I GGNCC 1 cut(s) 75
ScrFI CCNGG 1 cut(s) 90
SetI ASST 3 cut(s) 52, 208, 235
SfaNI GCATC 1 cut(s) 185
SspMI CTAG 1 cut(s) 182
StyD4I CCNGG 1 cut(s) 88
StyI CCWWGG 1 cut(s) 181
TaqI TCGA 1 cut(s) 44
TfiI GAWTC 1 cut(s) 127
TseFI GTSAC 1 cut(s) 4
Tsp45I GTSAC 1 cut(s) 4
TspDTI ATGAA 1 cut(s) 113
XceI RCATGY 1 cut(s) 192
XmaJI CCTAGG 1 cut(s) 181
XspI CTAG 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.